Labshake search
Citations for New England Biolabs :
301 - 350 of 1832 citations for 26S Proteasome Non ATPase Regulatory Subunit 10 PSMD10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... 10-100 nM M13mp18 scaffold (Bayou Biolabs) was incubated with an excess of staple strands (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: ... A 10 μl Gibson ligation reaction (NEB) was performed using 5 ng of the gel-purified inserts and 12.5 ng of the vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli strain 10-beta (New England Biolabs) or TOP10 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and treated with 10 units RppH (NEB) and 30 units T4 PNK (NEB) ...
-
bioRxiv - Genetics 2022Quote: ... 10 U of T7EI ((M0302S, NEB, USA) was added and incubated at 37 ℃ for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs). Lysates were centrifugated at 14,000 g for 10 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl 50% PEG 8000 (NEB, M0242), 1 μl 40 U μl-1 RNase Inhibitor (NEB ...
-
bioRxiv - Physiology 2019Quote: ... 4 μl of 10% NP-40 (NEB) and 8 μl of PNGase F (NEB ...
-
bioRxiv - Systems Biology 2019Quote: ... 10 U of T4 DNA ligase (NEB) and 33µl of T4 DNA ligase buffer (10x ...
-
bioRxiv - Systems Biology 2019Quote: ... and 10 U of RNase H (NEB) with RNase H buffer (10X ...
-
bioRxiv - Cell Biology 2019Quote: ... A 10 μl Gibson ligation reaction (NEB) was performed using 5 ng of the gel-purified inserts and 12.5 ng of the vector ...
-
bioRxiv - Genetics 2019Quote: ... and 10 U DNA polymerase I (NEB), made up to a final volume of 50 μl with H20.
-
bioRxiv - Genomics 2019Quote: ... 10 mg/ml BSA (NEB, Ipswich, America), T4 DNA ligase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... MNase (10 Units/sample; New England Biolabs) was added and reactions were incubated for 40 min at 37°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (New England Biolabs) was grown at 37 °C in LB medium supplemented with appropriate antibiotics as necessary for plasmid preparation ...
-
bioRxiv - Microbiology 2021Quote: ... 10 units of BstUI (Nex England Biolabs) were added to each reaction and incubation was conducted at 37°C for 3 h ...
-
bioRxiv - Genomics 2020Quote: ... 10 U T4-βGT (NEB, Ipswich, MA). The reaction was initiated by adding Fe (II ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µl 5x GC Buffer (NEB, USA), 1 µl dNTP mix (10 mM each ...
-
bioRxiv - Genomics 2021Quote: ... and 10 U T4 RNA Ligase1 (NEB). Reaction mixtures were incubated at 37°C for 2.5 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs), and centrifugated at 20,000 g for 2 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of enzyme (NEB, cat# R0543) was used in a 50 μl-reaction containing 5 μl of NEBuffer r3.1 (10X ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10-beta cells (New England Biolabs) with 5 μl of the assembly mix according to the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 units T4 PNK enzyme (NEB) at 37 °C for 30 min.
-
bioRxiv - Genomics 2022Quote: ... 10 µL 25U/µL MboI (NEB, #R0147L) and 5 µL water were added to each tube and incubate at 37°C with rotation for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 U/mL of DNaseI (NEB, M0303S), 1x cOmplete™ protease inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 µl of 10× CutSmart buffer (NEB), 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei ...
-
bioRxiv - Bioengineering 2023Quote: ... Escherichia coli 10-beta (New England Biolabs) was used for plasmid construction ...
-
bioRxiv - Bioengineering 2023Quote: ... NEB 10-beta (NEB cat. no. C3019), or NEB Stable (NEB cat ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Biophysics 2023Quote: ... 10 units of restriction enzyme XhoI (NEB) were added to the nucleosome array with and without PU.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RP1 primer (NEB), 1 µL ddH2O and PCR amplified for 16-18 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RPI primer (NEB), 2 µL 10 µM RP1 primer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10×T4 ligase buffer (NEB), 0.2 μl 0.1 M ATP (Thermo Fisher) ...
-
bioRxiv - Genomics 2023Quote: ... restriction enzyme (10 units of HpyCH4IV [NEB] for PCR7 and PCR31 ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
bioRxiv - Synthetic Biology 2023Quote: ... Scaffold strands (10 nM, M13mp18, Bayou Biolabs) were mixed with staple strands (100 nM ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Bioengineering 2023Quote: ... 10 µL HiFi 2X Master Mix (NEB), and water up to 20 µL ...
-
bioRxiv - Neuroscience 2023Quote: ... in 1:10 CutSmart Buffer (BioLabs #B6004S) at 37°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2023Quote: Restriction endonuclease BsaI (10 U/μL) (NEB), supplied with 10x NEB Buffer.
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB, S1402S)) and incubated overnight at 37°C in a humidified chamber ...
-
bioRxiv - Genomics 2023Quote: ... 10 μl Large Klenow Fragment (NEB #M0210L) was added and the chromatin is incubated for 15 min at 37°C with shaking ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 U of T7 endonuclease I (NEB) was added and incubated for 15 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 units of RNaseH (New England Biolabs) were added to the mix and allowed to digest at 37°C for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Biophysics 2024Quote: ... 10 units of calf intestinal phosphatase (NEB), 5 units of antarctic phosphatase (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.