Labshake search
Citations for New England Biolabs :
1651 - 1700 of 6017 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... RNA sequencing libraries were produced by using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770L). Quantification of the library was performed using a dsDNA HS Assay Kit and Qubit (Molecular Probes ...
-
bioRxiv - Cell Biology 2023Quote: ... Library preparation followed the NEBNext Ultra II DNA Library Prep Kit for Illumina protocol (New England Biolabs, MA, US). Size selection of adapter-ligated DNA was performed as described in the protocol ...
-
bioRxiv - Microbiology 2023Quote: ... library preparation was done with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), library preparation included 11 cycles of PCR amplification ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quality controlled RNA was converted to a sequencing ready library using the NEBNext Ultra II Directional RNA library kit with polyA selection as per the manufacturer’s instructions (New England Biolabs). The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing adapters were attached to the transposed DNA fragments using NEBNext Ultra II Q5 PCR mix (New England Biolabs), and libraries were amplified with 8 cycles of PCR ...
-
bioRxiv - Genomics 2023Quote: cDNA sequencing libraries were prepared with the NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB, #E7765L) and using the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: We prepared cDNA sequencing libraries using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB, #E7765L) and following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: NGS Libraries were made from eluted DNA using the NEBNext Ultra II DNA Library Prep kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... library preparation was done with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). A total of 33 million paired-end reads were generated.
-
bioRxiv - Plant Biology 2023Quote: ... The purified IP products were prepared into a library using NEBNext Ultra II DNA library prep kit (NEB E7103) using manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: NEB Ultra II directional RNA-Seq Library Prep kit protocol was used to prepare libraries for mRNA sequencing (NEB). An initial concentration of 500ng of total RNA was taken for the assay ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina following the manufacturer’s instructions (NEB). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: RNA-Seq: Directional RNA-Seq libraries (NEBNext Ultra II Directional RNA Library, New England Biolabs, Ipswich, MA NEB#E7760) were made according to the manufacturer’s protocol for 2 to 100□ng RNA as previously66 ...
-
bioRxiv - Neuroscience 2023Quote: RNA-Seq: Directional RNA-Seq libraries (NEBNext Ultra II Directional RNA Library, New England Biolabs, Ipswich, MA NEB#E7760) were made according to the manufacturer’s protocol for 2 to 100□ng RNA as previously66 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mRNA Magnetic Isolation Module and the NEBNext UltraTM II Directional RNA Library Prep Kit for Illumina according to the manufacturer’s instructions (New England Biolabs). Libraries were QC-checked on a Bioanalyzer 2100 (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... The library was prepared as per the user’s manual using the NEBNext Ultra II Directional RNA library Prep Kit for Illumina (E7760S, NEB). Library indexing was done with NEBNex multiplex oligos for Illumina Set 1 (E7335S ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were generated with the NEBNext® Ultra II Directional Library Prep Kit for Illumina (New England BioLabs), modified to use oligonucleotide sequences appropriate for the sequencing pipelines of the Wellcome Sanger Institute ...
-
bioRxiv - Genetics 2023Quote: ... Libraries for sequencing were amplified using unique dual index Illumina adapters and NEBNext Ultra II Q5 Master Mix (NEB). One purification step with Agencourt Ampure XP beads was performed before and after library amplification ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs #E7645L) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed to amplify libraries using the NEBUltra Ultra II DNA library prep kit for Illumina (NEB, E7645L). The final libraries were purified using AMP Pure XP beads (Beckmann Coulter ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs, E7645S) with the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... were further assembled and sequenced at GIGA-Liège University (Belgium) using the NEBNext Ultra II DNA library prep kit (New England BioLabs) and then sequenced on the Illumina NextSeq 500 platform with 2 × 150 nt reads with a target of 10 million sequences per pool of ten libraries (i.e ...
-
bioRxiv - Genomics 2023Quote: ... Purified DNA was submitted to library preparation using NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, E765). The samples were sequenced on a NovaSeq 6000 (Illumina ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: DNA for WGS was prepared by PCR-free library preparation according to the NEBNext DNA Ultra II kit (NEB). Sequencing was performed by Illumina NextSeq 2000 P3 150PE.
-
bioRxiv - Biochemistry 2023Quote: ... Sequencing libraries were prepared using NEBNext Ultra II RNA library prep kit using the manufacturer’s instructions (NEB, Ipswich, MA). Sequencing libraries were validated on the Agilent TapeStation and quantified using Qubit 2.0 Fluorometer as well as via quantitative PCR (KAPA Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... We prepared libraries using NEBNext® Ultra™ II DNA Library Prep with Sample Purification Beads (New England BioLabs). We indexed samples using NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 3 & Index Primers Set 4) ...
-
bioRxiv - Systems Biology 2023Quote: ... Dual-indexed sequencing libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) with 10 ng or 10 uL of input DNA (whichever was lower volume) ...
-
bioRxiv - Microbiology 2023Quote: ... The sequencing library was constructed with Ultra™ II Directional RNA Library Prep with Sample Purification Beads (NEB E7765) and sequenced on sequencing machine ...
-
bioRxiv - Genomics 2023Quote: ... Preparing the MLI1 DNA library was performed using NEBNext Ultra II DNA Library Prep kit (New England Biolabs, USA) and sequencing on an Illumina MiSeq with paired-end 300 bp reads at the “Molecular and Cellular Biology” core facility of the IMCB SB RAS (Novosibirsk ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted DNA fragments were amplified using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ChIP sequencing libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit reagents (NEB, Ipswitch, MA) according to the procedure recommended by the manufacturer ...
-
bioRxiv - Systems Biology 2023Quote: ... A pcDNA3.4 backbone was amplified with specific primers (Fw: GGTAAGCCTATCCCTAACCCTCT, Rv: AGGCGATCTGACGGTTCAC) using NEBNext Ultra II Q5 HotStart (NEB). The library insert and linearized backbone were assembled using the NEBuilder HiFi DNA assembly master mix and half of the reaction volume was transformed by electroporation into 100µL of NEB 10-beta electrocompetent E ...
-
bioRxiv - Plant Biology 2023Quote: ... ChIP DNA libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and RNA-Seq libraries were generated using the NEBNext® Ultra II Directional RNA Library Prep Kit (NEB # E7760L). Two biological replicates were sequenced using the Illumina NextSeq 550 platform to generate 150 bp PE reads.
-
bioRxiv - Microbiology 2023Quote: ... and DNA libraries were prepared using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs, NEB). DNA purifications and size selections were made using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... and DNA libraries were prepared using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs, NEB). DNA purifications and size selections were made using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-seq libraries were made using the NEBNext Ultra II Directional RNA Library Prep kit for Illumina (NEB, #E7760) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... RNA sequencing libraries were produced by using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770L). Quantification of the library was performed using a dsDNA HS Assay Kit and Qubit (Molecular Probes ...
-
bioRxiv - Neuroscience 2024Quote: ... Illumina library was made from polyA RNA with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s manual74 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing libraries were prepared using 50ng RNA according to the manufacturer’s recommendation for the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) and sequenced on the Illumina NextSeq 500.
-
bioRxiv - Microbiology 2023Quote: ... NEBNext® UltraTM II Non-Directional RNA Library Prep Kit for Illumina® (New England BioLabs Inc., MA, USA) was used for the remaining steps of library construction ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were prepared using NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs) per manufacturers protocol with 50-100 ng of DNA input and 5-6 cycles of PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing libraries were generated using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, UK) following manufactures’ protocol ...
-
bioRxiv - Microbiology 2023Quote: ... following ligation of barcodes a second end-prep was carried out using the Ultra II End Repair module (NEB). The rest of the protocol was carried out from the adapter ligation stage as per manufacturer’s protocol for LSK112 using the AMX-F adapter supplied in the early access Q20+ version of kit 112 ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina, NEB). The size of the resulting library was controlled by use of a D1000 ScreenTape (Agilent 2200 TapeStation ...
-
bioRxiv - Genomics 2023Quote: ... sgRNA libraries were recovered from gDNA via PCR amplification using NEBNext Ultra II Q5 Master Mix (New England BioLabs) according to manufacturer instructions and using custom primers (Extended Data Table 4) ...
-
bioRxiv - Genomics 2023Quote: 500 nanograms of total RNA were used for NEBNext® Ultra II Directional RNA Library Prep Kit (NEB # E7760L). Poly-A selection (NEBNext Poly (A ...
-
bioRxiv - Molecular Biology 2023Quote: Sequencing libraries were prepared using the NEBNext Ultra II DNA library prep kit according to the manufacturer protocol (NEB). Sequencing libraries were pooled and analyzed on a NextSeq 550 platform using paired-end mode with 32 cycles on both ends ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared using the NEBNext Ultra™ II Directional RNA Library Prep Kit for Illumina (New England Biolabs). sPOINT was performed in the same manner except immunoprecipitated RNA was treated with Terminator™ 5-Phosphate-Dependent Exonuclease (lucigen ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA fragments were then constructed into libraries using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645). 100M reads/read pairs per library were requested ...