Labshake search
Citations for New England Biolabs :
1601 - 1650 of 4002 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
bioRxiv - Plant Biology 2021Quote: ... Amino acid substitutions were generated with the Q5 site-directed mutagenesis kit (NEB) with specific primers (Supplemental Table 4) ...
-
bioRxiv - Genomics 2023Quote: Nucleic acids (gDNA, 1st strand cDNA) were amplified with Q5 polymerase (NEB, M0491) in 50 µL PCR reactions for 16 cycles with 500 nM landing-pad-specific primers (pDEST_HC_Rec_Bxb_v2_F/R ...
-
bioRxiv - Microbiology 2024Quote: ... Individual amino acid point mutants were generated using a Q5-SDM kit (NEB) using the B1 variant as template.
-
bioRxiv - Plant Biology 2020Quote: ... The amplified NbPRS4 PCR product was gel purified (Monarch DNA Gel Extraction Kit, New England Biolabs), digested with XbaI and XhoI (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were run on 1.5% agarose gel with 100bp ladder (New England Biolabs, Cambridge, MA) and visualized on an iBright digital gel imager (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... The ligated product was then chemically transformed into Escherichia coli DH5-α competent cells (NEB, Australia) following the company’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting PCR product was ligated into the pMal-c2x protein expression plasmid (New England Biolabs) adjacent to the malE gene to generate the pMAL-c2x-malE-L375-his10 plasmid encoding maltose binding protein (MBP ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10ul of PCR product was digested with 5 units of Msel (New England Biolabs, Ipswich, Massachusetts) for one hour ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Then every 5 μL of cleaned eluted product was redigested with 5μL of NotI-HF (NEB), 5 μL 10X CutSmart buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Genomics 2022Quote: ... 1 μg of PCR product containing barcoded oligos were inserted into 1 μg SfiI (NEB, R0123) digested empty vector A or P by gibson assembly NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR products were gel purified with Monarch® DNA Gel Extraction Kit (T1020S, New England BioLabs) according to manufacturer’s instructions and sent for NGS at the Gurdon Institute NGS core using an Illumina HiSeq 1500.
-
bioRxiv - Genomics 2020Quote: The polyadenylation product was mixed with 0.5 μL 10 mM dNTPs (New England Biolabs, Cat. # N0447L), 1 μL reverse transcription primers (25 ng/μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µl of PCR product was then mixed with 1.5 µl 10X NEBuffer 2 (B7002S, NEB) and 1.5 µl of Nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... RCA products were debranched using 10 units/ µg DNA of T7 Endonuclease I (New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The final PCR product was subcloned into pMiniT 2.0 vector (New England BioLabs, Whitby ON, Canada) and fully sequenced ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200 μL of PCR product was produced using Phusion Hotstart Flex polymerase (New England Biolabs, M0535S). The entirety of this PCR product was run on a gel ...
-
bioRxiv - Plant Biology 2021Quote: ... The construct pNOC-ARS-CRISPR-compact and the PCR product was digested with NheI/MfeI (NEB) and ligated to generate the vector pNOC-ARS-CRISPR-P2A-BlastR (Supplemental Dataset S2).
-
bioRxiv - Molecular Biology 2021Quote: ... The petSUMO_Nsp1_WT construct was then obtained using PCR-products with Gibson Assembly® Master Mix (NEB), according to the manufacturer’s protocol ...
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: ... Digested product was used as a template to set up first PCR with Taq polymerase (NEB), 1X Taq buffer ...
-
bioRxiv - Biophysics 2021Quote: ... which were each applied to ∼400 µL of magnetic Ni-NTA beads (NEB, product number S1423S), equilibrated at 4 °C in binding buffer (50 mM sodium phosphate ...
-
bioRxiv - Cell Biology 2021Quote: PCR products were gel purified and A-tailed by incubation with dATP and Taq Polymerase (NEB) for 30 minutes and ligated into pGEM-T-Easy (Promega).
-
bioRxiv - Neuroscience 2022Quote: PCR products were extracted with Monarch PCR & DNA Gel Cleanup Kit (New England Biolabs, Ipswich, MA) and sequenced by ABI 3730 automated DNA sequencer.
-
bioRxiv - Genetics 2022Quote: ... Both PCR products were used for constructing the final vector with Gibson assembly Master Mix (NEB), according to the instructions of the manufacturer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The final 5kb product was enriched by PCR with specific primers using Q5 2x MasterMix (NEB). Another round of assembly was repeated by mixing three 5kb fragments to generate 15kb fragments.
-
bioRxiv - Developmental Biology 2022Quote: ... sgRNAs were synthesized in vitro from purified PCR products by using the SP6 RNA-polymerase (NEB). 20 μL reactions contained 1 μg DNA template ...
-
bioRxiv - Developmental Biology 2022Quote: ... The 499 bp PCR product was cut with restriction enzyme Bsp1286I (New England BioLabs, Ipswich, MA). The mutant product was cut into 211 and 288 bp fragments ...
-
bioRxiv - Plant Biology 2021Quote: ... The USER-PCR products was treated with the USER enzyme (New England Biolabs, Ipswich, MA, USA) to remove all uracil residue ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were amplified and recombined using the NEBuilder HiFi DNA assembly kit (New England Biolabs) followed by Sanger sequencing for identification of positive clones ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5uL of the purified product was transformed using DH5-alpha Electrocompetent E.coli (NEB, Cat. No. C2986) on a Eppendorf Eporator® (Eppendorf ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR product and pUAST-attB vector were digested with NotI and Kpn1 restriction enzymes (NEB) and ligated to obtain the desired clones ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were incubated overnight at 60 °C with either BstNI restriction enzyme (New England Biolabs) or a control buffer solution without enzyme ...
-
bioRxiv - Cell Biology 2022Quote: ... two overlapping PCR products were generated using the high-fidelity DNA polymerase Q5 (New England Biolabs): one was the linearized recipient CD9 plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... Up to 1000 ng of purified PCR product was used with the HighScribe T7 kit (NEB) and incubated overnight at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... The amplified products were cloned using the NEB PCR cloning kit (New England Biolabs, Ipswich, MA). Clones from each founder were Sanger sequenced using the NEB analysis primers to define indels.
-
bioRxiv - Biochemistry 2021Quote: ... 5 µg of the PCR product was subjected to Fragmentase® treatment (New England Biolab, NEB) until a smear of fragments was detected around 400-500pb by agarose gel electrophoresis ...
-
bioRxiv - Genetics 2020Quote: ... 10 μL re-annealed PCR product was digested with 2 units T7 Endonuclease I (NEB #M0302L) in NEBuffer 2 for 60 min at 37°C ...
-
bioRxiv - Physiology 2021Quote: ... A-overhangs were added to Phusion products with one unit Taq polymerase (New England Biolabs; MO267S) followed by 10 min incubation at 72°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... The EnVT15159 PCR product was then digested using HindIII and AgeI high fidelity restriction enzymes (NEB) in Cutsmart buffer (NEB).
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using NEBMonarch PCR and DNA Clean-up Kit (New England Biolabs, USA), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were generated using the Q5 High-Fidelity DNA Polymerase (New England BioLabs, United Kingdom) with 50 ng genomic DNA as template ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified cDNA product was then amplified with the Illumina primers by the Q5 enzyme (NEB) with the PCR program (98 °C for 30 sec ...
-
bioRxiv - Microbiology 2021Quote: ... the amplified hoc product and pPROEX-HTb were digested with NcoI and SpeI (New England Biolabs) at 37°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... This was used as a base for site-directed mutagenesis using the Q5 Mutagenesis product (NEB) to generate mutations in the conserved asparagine residues N90 (OL9577 and OL10352) ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulted PCR product co-transformed with pEGFP-C1-2µ-URA3 cut with BamHI (NEB, R3136) into yeast strain BY4743 (EUROSCARF Y20000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were then isolated via gel electrophoresis and assembled using HiFi assembly mix (NEB #E2621L). Plasmids were verified by DNA sequencing and stored at -20°C until use in NanoBRET assays.
-
bioRxiv - Biochemistry 2023Quote: ... PCR products were purified using the Monarch® PCR & DNA clean-up kit (New England Biolabs). In vitro expression was performed for 2 h at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: The PCR product was purified and 1 µg was phosphorylated using 10 units T4 PNK (NEB) in 20 µl of T4 ligase buffer (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified PCR product and pET28a plasmid were incubated with NheI and BamHI restriction enzymes (NEB) following the manufacturer’s protocol for 3 hours ...