Labshake search
Citations for New England Biolabs :
51 - 100 of 8043 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: The Phusion high fidelity PCR master mix (New England BioLabs) was prepared with 0.2µM primers (forward sequence ...
-
bioRxiv - Microbiology 2020Quote: ... Phusion® High-Fidelity PCR Master Mix (New England Biolabs) 15 μl ...
-
bioRxiv - Immunology 2022Quote: ... PCR was performed using Phusion High Fidelity Master Mix (NEB) using optimized conditions (higher temperatures for annealing/extension of 72 °C ...
-
bioRxiv - Genomics 2023Quote: ... using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). The 2nd round PCR mixture was prepared and purified similarly to the 1st ...
-
bioRxiv - Molecular Biology 2023Quote: ... and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541S). All DNA clean-up steps were performed with AMPure XP beads (Beckman Coulter A63880) ...
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... were PCR amplified with Q5 High-Fidelity master mix (NEB) and cloned into pCFD4 (Addgene 49411 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 µL PCR reaction contained 1× OneTaq Master Mix (NEB), 0.2 µM of each primer ...
-
bioRxiv - Neuroscience 2024Quote: Genotyping protocols used either 2x Hotstart PCR Master mix (NEB) or 2x DreamTaq Green Master mix (Thermo Scientific K1081 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and NEBNext High Fidelity 2X PCR Master Mix (NEB, M0541). After purification with Qiagen MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... and Phusion High-Fidelity PCR Master Mix (New England Biolabs) were used to set up PCR reactions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and beads resuspended in a 50-µl PCR mix containing 1x NEBNext High-Fidelity PCR Master Mix (NEB) and 0.5 µM of Nextera Ad1_noMX and Ad2.X primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR indexing was performed using NEBNext High-Fidelity 2x PCR Master Mix (M0541S, NEB) and sequenced using a NextSeq platform (Illumina) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were amplified by PCR using NEBNext High-Fidelity 2x PCR Master Mix (NEB) using PCR primers Ad1_noMX and Ad2_Barcode (Sigma-Aldrich ...
-
bioRxiv - Physiology 2020Quote: ... was amplified by PCR (Phusion High-Fidelity PCR Master Mix, NEB, Hitchin, Hertfordshire, UK) using specific oligonucleotide primers (5’-TCGCTACTGTTTCTCTCGCA-3’ and 5’-AAAGGCGTCAACAACTGCTT-3’) ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA inserts were PCR-amplified using NEBNext High Fidelity PCR Master Mix (NEB, M0541). The resulting PCR amplicons were purified using Ampure XP Beads and sequenced using the HiSeq 2500 system (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... DNA was amplified by PCR with NEBNext HiFi 2x PCR Master Mix (NEB M0541S) and library was purified by 1.3X SPRI purification (Omega Bio-Tek ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed utilizing the Phusion High-Fidelity PCR Master Mix (NEB, M0531L) to prevent any mutations ...
-
bioRxiv - Genetics 2023Quote: ... PCR reactions were performed with Phusion High-Fidelity PCR Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using Phusion High-Fidelity PCR Master Mix (New English Biolabs, England). PCR products were quantified using 2% agarose gel electrophoresis ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR reactions contained 1X Phusion High-Fidelity PCR Master Mix (New England BioLabs Inc.), 0.5 μM primers (forward ...
-
bioRxiv - Immunology 2024Quote: ... and PCR amplified with NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). Following purification with the PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using NEBNext® High-Fidelity 2X PCR Master Mix (NEB; M0541S). The purified PCR products were separated by a 4-20% TBE gel (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... For PCRs we used Phusion High-Fiedlity PCR Master Mix with HF Buffer (NEB) and reactions were run as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Linearized cDNA was PCR amplified using Phusion High-Fidelity PCR Master Mix (NEB, M0531S).
-
bioRxiv - Genomics 2020Quote: ... 25.0 μl of 2x NEBNext PCR Master Mix (NEB cat M0541); and 7.0 μl nuclease free H2O ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1X Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), and 400 nM forward and reverse Fluidigm PCR primers in a 20 μL reaction volume ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR was performed using Taq 2X Master Mix (NEB, Ipswich, MA) with cDNA derived from mosquito whole body as a template ...
-
bioRxiv - Microbiology 2022Quote: ... 25 μL NEBNext High-Fidelity PCR Master Mix (New England Biolabs), 0.5 μM forward and reverse primers ...
-
bioRxiv - Microbiology 2022Quote: ... qRT PCR was performed using Luna Universal qPCR master mix (NEB) as per manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB). Amplification was carried out using the following program ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) was used with 0.5 ng input and the primers P5_Seq_Luc_F and P7_Ind_#_Han or P7_In_####_Han ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) was used with 0.5 ng cDNA and the primers P5_Seq_Luc_F and P7_Ind_##_Han ...
-
bioRxiv - Genetics 2020Quote: ... and NEBNext High-Fidelity 2X PCR Master mix (New England Biolabs) with 12 cycles ...
-
bioRxiv - Genetics 2020Quote: ... PCR was conducted using OneTaq 2x Master Mix (New England Biolabs) with forward and reverse primers following the program of 95°C×10min ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR was performed using LongAmp Taq 2X Master Mix (NEB M0287S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The eluate was PCR amplified using 2x NEBNext Master Mix (NEB) and pre-mixed primers with unique dual indexes for Illumina sequencing (IDT) ...
-
bioRxiv - Immunology 2023Quote: ... 2.5µl Evagreen and 2x Q5 PCR Master mix (NEB, Catalog #50492L) and end point PCR was performed using following program ...
-
bioRxiv - Cancer Biology 2023Quote: ... and NEBNext HiFi 2x PCR Master mix (New England Biolabs M0541). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs were performed using Q5 High-Fidelity Master Mix (NEB). All Gibson assemblies were performed using NEBuilder HiFi DNA Assembly (NEB).
-
bioRxiv - Synthetic Biology 2023Quote: All PCRs were done using Q5 2X Master Mix (NEB, M0492L). Primers were designed on Benchling (https://benchling.com/ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were carried out using Phusion Master Mix from NEB in a final volume of 25 µL for diagnostic PCRs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers purchased from Integrated DNA Technologies (IDT ...
-
bioRxiv - Systems Biology 2023Quote: ... 25 μL NEBNext Q5 HotStart HiFi PCR Master Mix (NEB, M0543S), and nuclease-free water for a total volume of 50 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... 25µL NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs), and 5µL of Nextera i5 and i7 indexed amplification primers (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL STAG_P701_NEX (10 uM) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL 10 μM STAG_iP7_a1 oligo (5’-CAAGCAGAAGACGGCATACGAGATATTTACCGCAGTGACTGGAGTTCAGACGT*G*T-3’) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 36.9 μL nuclease-free water and 2.5 μL of 10 μM sample index N (10x Genomics ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each 20 µL PCR reaction contained 1× OneTaq Master Mix (NEB), 0.2 µM of each primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... usingn Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The target PCR products were mixed with the same volume of 1 × loading buffer (contained SYBR green) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Duplex PCR was performed using Q5 Hotstart 2x Master Mix (NEB) with final primer concentrations of 0.5uM ...