Labshake search
Citations for New England Biolabs :
51 - 100 of 10000+ citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The U6 promoter was deleted and replaced with an XbaI site using NEB Q5 site directed mutagenesis kit (NEB Cat# E0554S) with primers forward ...
-
bioRxiv - Plant Biology 2023Quote: ... The DNA fragment was introduced into pGreen0179_YFP-(AauI)::35St with EXP7a promoter by using a NEBuilder HiFi DNA Assembly kit (NEB, MA, USA), and the resulting construct was transformed into Arabidopsis Col-0 by floral dip (Clough and Bent ...
-
bioRxiv - Molecular Biology 2023Quote: ... full length CDS of TaSnRK1α gene was amplified using the wheat cDNA and cloned into the pCAMBIA1302 vector under the constitutive promoter 35S using the Gibson assembly cloning kit (Gibson Assembly® Master Mix, NEB) with the help of restriction enzyme NcoI ...
-
bioRxiv - Bioengineering 2023Quote: ... and a gBlock (purchased from Integrated DNA Technologies [IDT]) containing an anhydrotetracycline (aTc) inducible promoter (pLTetO-1) were inserted via HiFi Assembly (HiFi Assembly Kit (NEB#E5520S)) into a PCR-ed fragment of plasmid pBbA2c-RFP (Addgene #35326 ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: DICER RNA substrates have been obtained using PCR synthetized linear DNA bearing T7 promoter and HiScribe T7 High Yield RNA Synthesis Kit (NEB #E2040S) following manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... downstream of the constitutive 35S promoter and upstream of the start codon of the GUS reporter using HiFi DNA assembly cloning kit (NEB E5520). Fragments of 35S promoter + vector backbone + GUS was amplified using forward primer ATGTTACGTCCTGTAGAAACCC and reverse primer GTCGACTCCAAATGAAATGAAC ...
-
bioRxiv - Immunology 2023Quote: ... Promoter regions were PCR amplified using Q5 polymerase (New England Biolabs) from C ...
-
bioRxiv - Immunology 2023Quote: ... adding a T7 promoter and an AG initiation sequence (Phusion, NEB): Fw primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... to assess rDNA promoter methylation or with HpaII (NEB, Cat# R0171) to assess 28S methylation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Hisx6 and associated stop codon was deleted by Q5 site directed mutagenesis (New England Biolabs). Two complimentary oligonucleotides corresponding to the Avi-tag (Avidity ...
-
bioRxiv - Molecular Biology 2020Quote: ... ATG-free versions of the truncated OpIE2 promoter sequence (tIE2 promoter with no ATG triplet in its sequence) were created by Q5 Site-Directed Mutagenesis (SDM) Kit (New England Biolabs-NEB, USA). Primers used to generate mutations were designed using the NEBaseChanger tool (NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were PCR amplified from genomic DNA of yeast strain BY474129 and cloned together with the bidirectional inducible Gal1-10 promoter into the PCR amplified pRSII42B backbone with OZL14 and OZL15 via Gibson assembly30 using NEBuilder Kit (NEB, catalog E2621). MMR-DN mutant genes were subsequently generated via site-directed mutagenesis using either Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ENO1-3’UTR and G6PD-CDS IDT PAGE purified oligos (Supplementary Table S6) containing T7 promoter were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB E2040). RNA was purified using TRIzol (ThermoFisher,15596026 ...
-
bioRxiv - Plant Biology 2023Quote: ... the NPTII gene cassette (including promoter and terminator) was cloned into pAGM1311 and modified using HiFi DNA Assembly Cloning Kit (NEB, Ipswitch, MA) to replace the complete coding sequence of NPTII with the coding sequence of the hygromycin resistance gene from pMDC735 ...
-
bioRxiv - Immunology 2021Quote: ... mRNA was generated from the T7 promoter in the linearized plasmids with the HiScribe T7 ARCA mRNA kit with tailing (NEB #E2060S, Ipswich, MA). We would typically use half of a kit (10 reactions ...
-
bioRxiv - Genetics 2021Quote: ... sgRNAs were synthesized directly from gBlock® DNA (IDT) templates containing the T7 promoter using the HiScribe™ T7 High Yield RNA Synthesis Kit (New England BioLabs E2050) following manufacturer’s instructions for sgRNA synthesis.
-
bioRxiv - Physiology 2022Quote: ... in zebrafish f5 proximal promoter sequences (Fig. 4E, Supplemental Table 5) (28) was conducted using a Q5 site-directed mutagenesis kit (NEB, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Transcription-unit (TU) plasmids were assembled with promoters and terminators from the MoClo kit using high-fidelity BsaI restriction enzyme (NEB, Ipswitch, MA, USA)51 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and used as templates for in vitro transcription (IVT) reaction by the T7 promoter using T7 polymerase and the HiScribe T7 High Yield RNA Synthesis kit (NEB, cat. no. E2040L). Template DNAs were removed by treating with DNase I at 37°C for 30 minutes and the IVT RNAs were further purified by RNA purification kit (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... lacI and tac promoter from pMAL-c5X (New England Biolabs, Ipswich, MA), (4 ...
-
bioRxiv - Genomics 2022Quote: ... and the CDC20 promoter amplicon were digested using SacI-HF (NEB, R3156S) and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the CDC20 promoter amplicon were digested using SacI-HF (NEB, R3156S) and XhoI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... downstream of the CMV promoter using NEBuilder HiFi Assembly (New England Biolabs).
-
bioRxiv - Neuroscience 2023Quote: ... where the ubiquitin promoter and EGFP were deleted by KLD mutagenesis (NEB), yielding pFCaGW ...
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Cancer Biology 2024Quote: ... ribosomal RNA depleted using NEBNext rRNA Depletion Kit (NEB, Human/Mouse/Rat) and strand-specific library preparation used NEBNext Ultra II mRNA kit (NEB ...
-
bioRxiv - Bioengineering 2021Quote: ... (4) lacI and tac promoter from pMAL-c5X (New England Biolabs, Ipswich, MA). The modified replacement plasmid for pMut2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Promoter substitution used the restriction enzymes AatII (10 units; R0117S, New England Biolabs) and NheI-HF (10 units ...
-
bioRxiv - Cancer Biology 2024Quote: ... The SFFV promoter is removed using Q5 site-directed mutagenesis (New England Biolabs). All plasmid constructs were verified using Primordium whole plasmid sequencing (Primordium Labs).
-
bioRxiv - Neuroscience 2023Quote: ... The original CBh promoter was removed by digesting with KpnI and AgeI (NEB). CAG promoter was amplified from pCAG-roxSTOProx-ZsGreen (Addgene #51274 ...
-
bioRxiv - Genetics 2024Quote: ... and replaced the minimal promoter and EGFP sequences using Gibson assembly (NEB, E2621L) to construct the SIN3A expression plasmid ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Genomics 2024Quote: A NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (Cat# E6310X, New England Biolabs) was used to deplete rRNA from the previously prepared total RNA ...
-
bioRxiv - Genetics 2021Quote: ... These Promoters were amplified by PCR and individually inserted by Gibson assembly (#E2611S; NEB) into the Downstream assay vector ...
-
bioRxiv - Microbiology 2022Quote: ... different promoter regions were amplified using the Phusion® high-fidelity DNA polymerase (NEB) from purified genomic DNA ...
-
bioRxiv - Microbiology 2021Quote: ... then promoters were ligated into pNLP3 using T4 DNA ligase (New England BioLabs Inc). Ligated constructs were transformed into One Shot electro- or chemically competent TOP10 E ...
-
bioRxiv - Cell Biology 2020Quote: ... the CaMKIIa promoter was excised using MluI and BamHI restriction endonucleases (New England Biolabs) and replaced by a CMV promoter excised from pcDNA™3.1/Zeo(− ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... downstream of promoter pBAD employing USER cloning (New England Biolabs,(Cavaleiro et al., 2015)) ...
-
bioRxiv - Microbiology 2023Quote: ... The digoxigenin-labeled RNA probes were transcribed from PCR products containing a T7 RNA polymerase promoter fused to gapA sequences with T7 RNA polymerase (New England Biolabs) and DigRNA labeling mix (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2024Quote: ... These PCR products were used for Gibson assembly with the barcoded promoters (#E2611S; NEB). Gibson assembly reactions were purified with magnetic beads and 2 µl of the reaction were electroporated into 20 µl of electrocompetent e ...
-
bioRxiv - Developmental Biology 2024Quote: ... then assembled with the ckb-3 promoter via Gibson assembly (New England Biolabs, US).
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs) according to the manufacturer’s instructions without modifications ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The promoter of PhFTL9 was amplified using Phusion High-Fidelity DNA Polymerase (New England Biolabs) from genomic DNA ...
-
bioRxiv - Genomics 2020Quote: ... two templates with T7 promoter sequences were generated by performing PCR amplification (Q5 Polymerase, NEB) off of GeCKO v2.0 plasmid DNA using H1T7 and H1R primers for probe 1 and primers T2RT7 and T2F for probe 2 (Supplemental Table 4) ...
-
bioRxiv - Microbiology 2021Quote: ... The AdmarRars promoter was chemically synthesized and subcloned into expression vector pACYC184 (NEB, United States), generating plasmid pACYC184-PmarRars-gfp (Fig ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The spiralen promoter and mCherry gene were amplified using Q5 master mix (New England Biolabs), with the plasmid pTF20mChloxp (gift from Kevin Dybvig ...