Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... made from pCX with the promoter replaced by human Synapsin (hSyn) using golden gate assembly (NEB). For synaptic labelling pCAG-GPHN-FingR-EGFP-CCR5TC40 Addgene # 46296 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the promoter EF1α and human DGCR8 sequences were removed using the restriction enzymes FseI and BsBtI (NEB). After ligation ...
-
bioRxiv - Neuroscience 2024Quote: ... The promoter was cloned using the Gibson Cloning Assembly Kit (New England BioLabs) following standard procedures ...
-
bioRxiv - Synthetic Biology 2022Quote: ... sgRNA expression plasmids were constructed via digesting the sgRNA backbone plasmids that contained a human U6 promoter and a Cas-nuclease’s corresponding sgRNA scaffold sequences using BsmB I or Bbs I endonuclease (NEB) and then ligated the oligonucleotide duplexes into this cut backbone ...
-
bioRxiv - Developmental Biology 2023Quote: ... The two strands of the gRNA were annealed and cloned downstream of the human U6 promoter using the BbsI (NEB) restriction site in the plasmid pU6-(BbsI)_CBh-Cas9-T2A-BFP (Addgene) ...
-
bioRxiv - Genomics 2022Quote: ... w/o any promoter for promoter-assays were first digested using EcoRV (New England Biolabs, R3195S). Next ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins associated to chromatin (pellet) were treated with DNaseI (NEB). Finally ...
-
bioRxiv - Biophysics 2021Quote: We produced the vector PB PGKp-PuroR L30p MCS-GDGAGLIN-HaloTag-3xFLAG by amplifying the human L30 promoter with prAH675 and prAH676 and assembling into AsiSI- (NEB R0630) and XbaI- (NEB R0145 ...
-
bioRxiv - Microbiology 2024Quote: ... Promoter fragment and linearized vector were ligated using NEBuilder Assembly kit (E5520S – New England Biolabs). Ligated plasmids were transformed into heat-shock competent TOP10 E ...
-
bioRxiv - Microbiology 2021Quote: ... in which the TUB8 promoter had been deleted using the Q5 Site-Directed Mutagenesis Kit (NEB) protocol with primers P1/P2 ...
-
bioRxiv - Microbiology 2023Quote: ... and then were incubated with linearized pGL3-promoter vector and the Gibson Assembly Kit reagents (NEB). Reactions were then transformed into competent Top10 E ...
-
bioRxiv - Microbiology 2020Quote: ... associated with EnGen™ Spy Cas9 NLS protein (New England BioLabs), using the 4D-Nucleofector™ System (Lonza ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Genetics 2023Quote: ... The linearized Luc-shRunx2 vector and 1cisCXp promoter were further assembled together using Gibson Assembly Kit (NEB). A conceptual schematic of the gene circuits function is shown in Fig ...
-
bioRxiv - Microbiology 2023Quote: ... and then associated with EnGen Spy Cas9 NLS protein (New England BioLabs) using the 4D-Nucleofector system (Lonza) ...
-
bioRxiv - Cancer Biology 2021Quote: ... vector was generated by replacing the Ef1a promoter with a CMV promoter cassette in pLV-Ef1a-Cre-U6-sgRNA(MS2) using PCR and HiFi assembly (NEB). The pLV-CMV-CreERT2-P2A-[puroR/zeoR/hygR]-U6-sgRNA(MS2 ...
-
bioRxiv - Bioengineering 2024Quote: ... Transcription templates were made by site directed mutagenesis to substitute the T7 promoter with the promoter of interest on pCMV-Cluc2 (New England Biolabs).
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ with different conjugated molecules and BAD variants conjugated with mCitrine were subcloned to the multiple cloning site (MCS-2) using EcoRI and XbaI (NEB; # R0145S) and the MCS-1 using MluI-HF (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Site-directed mutagenesis or promoter deletions were performed with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). PCR reactions were done in 50 μL containing 25 μL of Q5 Hot Start High-Fidelity 2X Master Mix ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Sox2 promoter was cloned by first removing the Ef1a promoter from the 3-SB-EF1-PBBAR-SB vector using NdeI (NEB, R0111) and SalI (NEB ...
-
bioRxiv - Genetics 2021Quote: ... and ligated with the amplicons Uro promoter and GeneSwitch using NEBuilder HiFi DNA Assembly Kit (NEW ENGLAND BioLabs, E2621X). Transgenic lines were generated using standard methods for P-element-mediated germline transformation (BestGene Inc).
-
bioRxiv - Microbiology 2023Quote: ... and cloned into pTM1 (a pDONR/Zeo based plasmid) downstream of the ACT1 promoter using Gibson cloning kit (NEB), and then introduced into pDG33 using Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... capsulatus anfH promoter via Golden Gate assembly50 using NEBridge Golden Gate Assembly Kit (New England Biolabs, Ipswich, Massachusetts, USA) into a broad-host range plasmid pOGG02451 (pMM0165) ...
-
bioRxiv - Genomics 2023Quote: ... The divergent promoter inserts for Gibson assembly (NEB #E2621L) were generated by digesting PDp82 with SalI and AvrII ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... was transcribed from a sgRNA-coding PCR product with a 5′ T7 promoter sequence using HiScibe T7 Quick High yield RNA Synthesis kit (NEB). The transcription was performed at 37 °C overnight and then purified by phenol ...
-
bioRxiv - Plant Biology 2021Quote: ... IPT3 promoter DNA sequence was extracted and purified from the gel using Monarch DNA Gel Extraction Kit (New England Biolabs) and Sanger sequenced at Genewiz (South Plainfield ...
-
bioRxiv - Molecular Biology 2020Quote: ... Guide RNAs were cloned into a T7 promoter vector followed by in vitro transcription (HiScribe T7 High Yield RNA Synthesis Kit, New England BioLabs) and spin column purification (RNeasy ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of purified DNA of each template including the T7 promoter at the 5’ end was used following the manufacturer instructions (HiScribe T7 High Yield RNA Synthesis kit, NEB). Primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the corresponding promoter sequences were inserted in the DNA templates using Q5 Site-Directed Mutagenesis Kit (E0554, New England Biolabs). DNA templates encoding for functional mRNAs ...
-
bioRxiv - Microbiology 2024Quote: ... Genes of interest were PCR amplified to include either their native or heterologous promoter and cloned using Gibson Assembly kit (NEB) into integration vectors pDG1662 (for insertion into the amyE locus) ...
-
bioRxiv - Immunology 2024Quote: ... pUC57-mini plasmids harboring the WT or mutated coding sequence downstream of T7 promoter were first transcribed into mRNA using the HiScribe T7 ARCA mRNA Kit (New England BioLabs) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids containing either rpsL-cat or the inducible promoter tetO1 [18] flanked by regions homologous to the DNA up- and downstream of the ggt-promoter were constructed using a commercially available Gibson Assembly Cloning Kit (NEB). Homologous regions were amplified from the genomic DNA of strain PMSS1 using primer pairs FlgK fwd/FlgK rev (rpsL/tetO1 ...
-
bioRxiv - Microbiology 2023Quote: ... The amplicons were inserted into pMQ123 downstream of the Ptac promoter using the NEBuilder HiFi DNA Assembly kit (New England BioLabs) according to the manufacturer specifications ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Developmental Biology 2023Quote: ... an SP6 promoter was inserted upstream of the transcriptional start using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). All plasmids were confirmed by sequencing.
-
bioRxiv - Genomics 2023Quote: Constructs encoding either a GFP or an RFP protein were PCR amplified and in-vitro transcribed from a T7 promoter with the HiScribe T7 Kit (NEB), using a mixture of ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 bp Cy3‐UTP labeled RNA was generated using a PCR‐product containing a T7‐promoter site and the HighScribe T7 high yield RNA synthesis kit (NEB) as well as Cy3‐UTP (Jena Bioscience) ...
-
bioRxiv - Plant Biology 2024Quote: ... Mutant versions of the promoter were generated from the wild type (WT) clone using the Q5 Site-Directed Mutagenesis Kit (NEB) and mutagenic primers (Table S1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... starting from the T7 promoter region in the insert cassette using the HiScribe T7 High Yield RNA Synthesis Kit (NEB). Transcribed gRNA was cleaned using the RNA Clean and Concentrator kit (Zymo).
-
bioRxiv - Microbiology 2021Quote: ... Amplification of promoter regions was performed with Phusion polymerase (NEB) with the A1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and in the YB_TATA minimal promoter using SpeI-HF (NEB). The natural TF binding site array inserts were designed to match these overhangs and replace the part of the YB_TATA minimal promoter that was removed when linearizing the backbone ...
-
bioRxiv - Plant Biology 2023Quote: ... with the native ACO2 promoter using Gibson Assembly® (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the promoter sequences were cut out using SpeI (NEB #R3133) and AscI (NEB #R0558 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Promoter sequences were then inserted upstream using SpeI (NEB #R3133) and AscI (NEB #R0558 ...
-
bioRxiv - Microbiology 2020Quote: ... The sgRNAs were then associated with EnGen® Spy Cas9 NLS protein (New England BioLabs) at room temperature for 20 min ...
-
bioRxiv - Biochemistry 2023Quote: ... MBP-ICD (and associated W22R “black” mutant) was purified through amylose resin (New England Biolabs), followed by cation exchange chromatography using a Source 15S column (GE Healthcare ...
-
bioRxiv - Genomics 2023Quote: ... driven by a CBh promoter and mCherry driven by an EFS promoter were inserted using BsrGI and Acc65I restriction enzymes (NEB, Cat# R3575S and R0599S, respectively) into the XLone-GFP plasmid (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... The BAG1 promoter fragment and EGFP ORF or mCherry (ORF) were cloned by NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520S) into the vector backbone that was produced by double enzymatic digestion of pTUB1:YFP-mAID-3HA ...