Labshake search
Citations for New England Biolabs :
901 - 950 of 3671 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... a test transformation was performed with 1uL of the 20uL SPRI purified Gibson assembly mixture and 50uL of 10-beta electrocompetent cells (NEB) to determine the optimal amount of Gibson assembly and 10-beta cells to achieve the desired colony-forming unit (CFU ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 μL of the product was transformed by heat shock into 10-beta competent cells (New England Biolabs, C3019I). Cells were then plated on agarose plates (supplemented with ampicillin 100 μg/mL ...
-
bioRxiv - Biochemistry 2024Quote: ... was incubated in a reaction volume of 50 µl at 37°C for 18 h with 10 U of T4 beta-glucosyltransferase (T4-BGT) in the presence of 80 µM UDP-glucose in NEBuffer 4 (all New England Biolabs). Control reactions were incubated without T4 beta-glucosyltransferase ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 μL of the product was transformed by heat shock into 10-beta competent cells (New England Biolabs, C3019I). Cells were then plated on agarose plates (supplemented with ampicillin 100 μg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcriptase and RT-qPCR reactions were conducted using the Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA, United States). The reaction was performed with 50 ng of total RNA in a total volume of 20 µL ...
-
bioRxiv - Genomics 2020Quote: ... Total RNA was used to prepare 48 separate cDNA libraries to produce 100 base pair paired end reads using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, Massachusetts, USA). Each library was individually barcoded with NEBNext dual adaptors (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μg RNA was used to generate a pair-end sequencing library using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to track sequences to each sample ...
-
bioRxiv - Biochemistry 2020Quote: ... pGFP2-N3 and pRluc-N1 for POR) after each was digested by the indicated pair of restriction enzymes (New England Biolabs, Inc.; Ipswich, MA). The multiple cloning sites of the vectors are upstream of the GFP or Rluc tag ...
-
bioRxiv - Biochemistry 2022Quote: ... The two pairs of PCR products were ligated together by in vitro homologous recombination using a Gibson assembly cloning kit (NEB, Boston, MA, USA), respectively ...
-
bioRxiv - Genomics 2023Quote: ... a standard whole-genome 150 base pair (bp) paired-end Illumina library was prepared using the NEBNext Ultra II library preparation kit (New England Biolabs Inc., Ipswich, USA). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of Klenow 3’ to 5’ exo (5 U/μL, NEB), and samples were incubated in a thermocycler at 37°C for 30 min ...
-
bioRxiv - Genetics 2021Quote: ... The forward primer was phosphorylated with T4 polynucleotide kinase (New England Biolabs) and used in a high fidelity PCR reaction (see below ...
-
bioRxiv - Developmental Biology 2020Quote: ... by using primers with BamHI-HF (New England Biolabs, 20U/ml, #R3136S) and XbaI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... single primer site-directed mutagenesis was performed with Q5 DNA polymerase (NEB) and primer #8964 to change the Cys21 codon (TGT ...
-
bioRxiv - Genomics 2020Quote: ... with NEBNext Multiplex Oligos for Illumina primer sets (NEB #E7335 and #E7500). mRNA libraries were quality controlled via TapeStation then pooled and sequenced using single-end 75 bp reads on an Illumina MiSeq instrument in the UT Southwestern McDermott Center Next Generation Sequencing Core Facility.
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed using the NEBuilder tool (New England Biolabs, Ipswitch, MA), inserts were synthesized as gBlocks and purchased from Integrated DNA Technologies (Integrated DNA Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... with either single index or dual index primers also obtained from NEB. We followed the manufacturer’s instructions except for the following variations:
-
bioRxiv - Microbiology 2021Quote: ... The primers were obtained using the NEBuilder Assembly Tool (New England Biolabs). After digestion by DpnI (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the forward primers were phosphorylated using T4 polynucleotide kinase (New England Biolabs) to facilitate T4 ligation later ...
-
bioRxiv - Cell Biology 2021Quote: ... from pSJ1256 using primers containing the PacI and AscI (New England BioLabs) restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... excessive primers were removed with an enzymatic protocol using exonuclease I (NEB) and quick CIP (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... we reverse-transcribed cDNA with a random primer mix (NEB, MA, USA) and GoScript™ Reverse Transcriptase (Promega ...
-
bioRxiv - Systems Biology 2021Quote: ... NEB_EC2H_Barcode_F: GACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGAACTATTTCCTGGCTGTTACGCG and NEBNext Universal PCR Primer for Illumina (New England Biolabs). The thermocycling parameters were 95 °C for 3 min ...
-
bioRxiv - Microbiology 2021Quote: ... with NEBnext Multiplex Oligos for Illumina (Primer Set 1) (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2020Quote: ... used dual index primers (from NEBNext Multiplex Oligos for Illumina, NEB E7600S) for multiplexing ...
-
bioRxiv - Pathology 2021Quote: ... using custom synthesized complementary primers (IDT) and the Gibson assembly kit (NEB). After verifying the DNA sequence of the pcDNA3-4 fused with the cDNA for ace2 1-618-ddc-abd ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was generated using oligo (dT) 18 primer (New England Biolabs, 513165) and SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... NEBNext Multiplex Oligos for Illumina Dual Index Primer Set 1 (NEB, E7600S) was used for library construction ...
-
bioRxiv - Biophysics 2021Quote: The NNS primers were phosphorylated with T4 polynucleotide kinase (NEB, cat#M0201S). 20 μL phosphorylations was prepared according to the following recipe ...
-
bioRxiv - Genomics 2021Quote: ... excess primers were removed using an Exonuclease I digestion (New England Biolabs), second strand synthesis was performed ...
-
bioRxiv - Genomics 2021Quote: Purified RNA (5 ug) was reverse transcribed using Random Primer 9 (NEB) and SuperScript II reverse transcriptase under error prone conditions as described Smola et al. ...
-
bioRxiv - Genomics 2021Quote: Purified RNA (9 μg) was reverse transcribed using Random Primer 9 (NEB) and SuperScript II reverse transcriptase under error prone conditions as described in Smola et al. ...
-
bioRxiv - Immunology 2020Quote: ... RNA and primer dimers were digested using RNAseA and Lambda Exonuclease (NEB) after which cDNA was amplified using the Kapa Biosystems HiFi HotStart ReadyMix (2X ...
-
bioRxiv - Immunology 2020Quote: ... Beads were then treated with ExoI to digest unoccupied primer sites (NEB).
-
bioRxiv - Immunology 2022Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB, E7335S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were dual-indexed (NEBNext Dual Index Primers Set 1, NEB E7600S), and sequenced on an Illumina NextSeq 2000 instrument with P3 300 cycle reagents ...
-
bioRxiv - Genomics 2022Quote: ... specific primers (Supplementary Table S1) were radiolabelled with T4 Polynucleotide kinase (NEB) and [?-32P]ATP (6,000 Ci/mmol) ...
-
bioRxiv - Plant Biology 2022Quote: ... and ZmCYP71Z16 using gene-specific primers and Phusion polymerase (New England BioLabs) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... with NEBnext Multiplex Oligos for Illumina (Primer Set 1) (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... 20μM random primers (Thermo, SO181) and 1mM dNTP (NEB, N0446S and N0459S), then they were incubated at 98°C for 3min and immediately cooled down at 4°C for 20min ...
-
bioRxiv - Molecular Biology 2024Quote: ... To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB) (Smola et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... was mutated using Q5 site directed mutagenesis kit (NEB, primers: SP (RSV) AP2 (hTFAP2A)-CRISPR RES-fw and SP (RSV ...
-
bioRxiv - Developmental Biology 2024Quote: ... A primer extension reaction was performed using Phusion DNA polymerase (M0530L, NEB) followed by QIAquick purification (28106 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by cDNA synthesis with oligoT primers (ProtoScript II, New England Biolabs). The TaPOR2 gene lacking the part coding a transit peptide and pET15b plasmid (Novagen ...
-
bioRxiv - Microbiology 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB, #E6440G), followed by 2×150 bp sequencing on the Illumina MiSeq ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB E7335) according to manufacturer’s instructions ...