Labshake search
Citations for New England Biolabs :
8601 - 8650 of 9358 citations for Rat Leptin RIA kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Poly(A)-enriched libraries for sequencing were then generated using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA). Paired-end sequencing was performed on the Illumina NextSeq instrument at the Harvard University Bauer Core ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA of TET21-N cells (Control and 24 h doxycycline) was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs, Hitchin, UK), from which complementary DNA (cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... NEBNext® UltraTM II Directional RNA Library Prep Kit for Illumina® and NEBNext® UltraTM II DNA Library Prep Kit for Illumina® according to the manufacturer’s instructions (New England Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... strand-specific RNA-seq libraries were constructed by using the NEB Next® UltraTM Directional RNA Library Prep Kit for Illumina® (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ENO1-3’UTR and G6PD-CDS IDT PAGE purified oligos (Supplementary Table S6) containing T7 promoter were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB E2040). RNA was purified using TRIzol (ThermoFisher,15596026 ...
-
bioRxiv - Biochemistry 2022Quote: ... The resultant multiple overlapping DNA fragments were joined in a single isothermal reaction using a Gibson assembly cloning kit (New England Biolabs cat # E2611S). We designed our Gibson assembly primers to assemble the DNA fragments in the following order ...
-
bioRxiv - Cancer Biology 2022Quote: ... Full length TEAD1 and TEAD2 coding sequences were amplified from pCMX-GAL4-TEAD1 and pCMX-GAL4-TEAD2 and cloned into the EcoRI site of pCDNA3.1 by Gibson assembly using the NEBuilder® HiFi DNA Assembly Kit (New England Biolabs Cat. #E2621). The TEAD3 gBlock fragment was similarly cloned into the EcoRI site of pCDNA3.1 by Gibson assembly ...
-
bioRxiv - Cancer Biology 2022Quote: ... The CUT&RUN library was prepared using a NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645, E7710) as previously reported (Zhu et al ...
-
bioRxiv - Immunology 2022Quote: ... and unc-54 3’utr pieces were Gibson assembled using the NEBuilder assembly kit and the assembled product was then PCR-amplified with Phusion DNA polymerase (New England Biolabs, Ipswich, MA). The PCR-amplified assembly was A-tailed for 30 min at 70 °C ...
-
bioRxiv - Immunology 2022Quote: Plasmids containing a cDNA encoding the full-length M segment from SNV (pWRG/SN-M(opt) 67 and pWRG/AND-M(opt2) 68 were used mutagenized using the Q5 Site-Directed Mutagenesis Kit (NEB, Cat# E0554S). Primers were designed using the NEBaseChanger tool (https://nebasechanger.neb.com/) ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Genetics 2022Quote: ... cDNA was produced from 100 ng of total RNA using the ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, E6560L) with the d(T)23 VN primer ...
-
bioRxiv - Genetics 2022Quote: ... approximately 50 ng of gDNA was used as input to the NEB Ultra II FS Library Prep Kit for Illumina (NEB cat. E7805L). Libraries were then sequenced using either paired end 2×36 bp or 2×72 bp read chemistry ...
-
bioRxiv - Immunology 2022Quote: RNA from sorted Kmt2d-knockout and littermate control thymic cells was isolated by centrifugation to pellet and resuspended in 300 μL of Protection Buffer (Monarch RNA Isolation Kit, #T2010S; New England Biolabs Inc. (NEB), Ipswich ...
-
bioRxiv - Immunology 2022Quote: ... as described by Corman et al84 were used alongside the Luna Universal One-Step RT-qPCR kit (New England Biolabs, Ipswitch, MA) and CFX384 Touch Real-Time System (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 200 fmol of DNA (determined following quantification with the Qubit™ dsDNA HS Assay Kit) was processed using the NEBNext Companion Module for ONT Ligation Sequencing (NEB, #E7180). Sequencing adapters were added using the Ligation Sequencing Kit (ONT ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation was performed using the NEB ultra DNA library preparation kit for Illmina (E7370) and Indexing primers (E7335S and E7500S) (New England Biolabs Inc, UK), following protocols described previously (Colles ...
-
bioRxiv - Neuroscience 2022Quote: ... the 181-bp and 376-bp amplicon products (Figure 1-figure supplement 1A) were purified using the Monarch PCR & DNA Cleanup Kit (New England Biolabs, Ipswich, MA) and sent for Sanger DNA sequencing at the OHSU Vollum Sequence Core (Portland ...
-
bioRxiv - Immunology 2022Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Microbiology 2022Quote: RNA was in vitro transcribed from 1 μg of agarose gel-purified band corresponding to the intended size using HiScribe™ T7 high yield RNA synthesis kit (cat#E2040S, New England Biolabs Inc) followed by adding a 5’ cap using the Vaccina Capping System (cat#M2080S ...
-
bioRxiv - Microbiology 2022Quote: Libraries for metagenome sequencing were generated using NEB Next® Ultra™ DNA Library Prep Kit for Illumina® (New England Biolabs), following the manufacturer’s recommendations with the addition of index codes ...
-
bioRxiv - Microbiology 2022Quote: ... RNA sequencing libraries were prepared using NEBNext Ultra II RNA Library Preparation Kit for Illumina by following the manufacturer’s recommendations (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Systems Biology 2022Quote: ... The RNA sequencing library was prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Systems Biology 2022Quote: ... The library for RNA-seq was prepared by using NEBNext Ultra II Directional RNA Library Prep kit (New England BioLabs, Ipswich, MA) and the sequencing was run on an Illumina HighSeq2000 with paired end reads ...
-
bioRxiv - Systems Biology 2022Quote: ... The sample preparation was performed according to the protocol “NEBNext Single Cell/Low Input RNA Library Prep kit for Illumina”(NEB #E6420S/L). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: Sequencing libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (E7645, New England BioLabs) with NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were prepared using a polyA selection method using the NEBNext Ultra II RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA) and quantified using Qubit 4.0 Fluorometer (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... at -80 °C prior to RNA extraction and library preparation (performed by Novogene Company Limited with NEB Next® Ultra™ RNA Library Prep Kit (NEB)) prior to RNA sequencing (paired-end 150 bp ...
-
bioRxiv - Microbiology 2023Quote: ... Strand-specific RNA sequencing library was prepared by using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... mRNA Magnetic Isolation Module and NEB Next Ultra II Directional RNA Library Prep Kit for Illumina with NEB Next Multiplex Oligos for Illumina (New England Biolabs Inc., USA), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... Library preparation was performed with Poly A selection and HiSeq xSequencing using NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Sequencing libraries were clustered onto 1 lane of a flow cell ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext Ultra II DNA library Prep Kit for Illumina (NEB Cat# E7645S) according to the manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... the NPTII gene cassette (including promoter and terminator) was cloned into pAGM1311 and modified using HiFi DNA Assembly Cloning Kit (NEB, Ipswitch, MA) to replace the complete coding sequence of NPTII with the coding sequence of the hygromycin resistance gene from pMDC735 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... libraries were constructed with the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, USA). DNA libraries for museum or archeological samples were built using a Blunt-End Single-Tube (BEST ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 7 ng of RNA per sample using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, E6420). Libraries were pooled and sequenced using a P3-100 kit from Illumina in a NextSeq2000 sequencer following manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 2 ng of RNA per sample using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, E6420). Libraries were pooled and sequenced using a P3-100 kit from Illumina in a NextSeq2000 sequencer following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: Insertion of point mutations in mPiezo2 and the chimeric channel mP1/mP2 were carried out using the Q5® Site-Directed Mutagenesis Kit (NEB, Inc) according to the manufacture’s indications ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: DNA from two samples (R-F1-E and S-F3-N) were used for preparing DNA metagenome libraries using NEBNext Ultra DNA Library Prep Kit (NEB, Ipswich, MA) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: 150 ng RNA was used to prepare libraries using the NEBNext Ultra II Directional mRNAseq kit with poly(A)+ purification module (NEB E7760, E7490) as described with modifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the entire ChIP DNA and 300 ng input DNA were used to construct libraries using NEBNext Ultra™ II DNA Library Prep kit for Illumina (NEB, E7645) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: DNA was isolated from 100 µL of whole blood using the blood protocol from the Monarch® Genomic DNA Purification Kit (New England Biolabs, Australia). In addition ...
-
bioRxiv - Neuroscience 2022Quote: ... Transcriptomic profile of individual BAT samples was performed using commercial RNA-sequencing kits (NEBNext mRNA Library Prep Master Mix and NEBNext Multiplex Oligos for Illumina, New England Biolabs, Ipswich, MA) and adapted according to previous descriptions [22] ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were then run on a 3% agarose gel and the product was extracted using NEB Monarch DNA Gel Extraction Kit (NEB, Cat# T1020L). Next ...
-
bioRxiv - Physiology 2022Quote: ... and RNAseq libraries constructed using an NEBnext Ultra RNA library prep kit with a poly A purification module (New England Biolabs, Ipswich, MA). Libraries were indexed using multiplex adapters made by IDT (Coralville ...
-
bioRxiv - Microbiology 2022Quote: ... The sequencing library for total RNA-sequencing was prepared using NEB Next Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Cat# E7530). Paired-end ...
-
bioRxiv - Cancer Biology 2022Quote: ... We designed spCas9 guide RNAs to target codon 12 of the human KRAS gene and selected the one with highest targeting efficiency determined by T7E1 mismatch assay (EnGen Mutation Detection Kit, New England Biolabs, Ipswich, MA). Truncated guide RNA was produced by PCR assembly of a guide RNA template (56 ...