Labshake search
Citations for New England Biolabs :
801 - 850 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was PCR-amplified for 25 cycles with 5’-Cy3-labelled reverse primers (IDT) and unlabeled forward primers using either Taq polymerase or Phusion high-fidelity polymerase (NEB). PCR products were separated on 40cm tall 6% polyacrylamide denaturing gels and then visualized using a Molecular Dynamics Typhoon Scanner ...
-
bioRxiv - Microbiology 2021Quote: ... All mutant plasmids were generated using the Q5 site-directed mutagenesis kit using PAGE-purified mutagenesis primers designed using the online NEBase Changer primer design tool (New England BioLabs). The mCherry plasmid was created by cloning mCherry into the multiple cloning site of pTriEx-3 (Novagen ...
-
bioRxiv - Plant Biology 2020Quote: First amplification was done in 20 μL with DegPstI (degenerated primers) and Rb1 (on the aphVIII cassette) primers with Taq polymerase (NEB) using 58°C annealing temperature for 5 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5ul of 10uM NEB universal primer and 10uM NEB index primer (in NEBNext Multiplex Oligos for Illumina, NEB E7335, E7500), 0.5ul of Phusion DNA polymerase and 21.5ul H2O ...
-
bioRxiv - Microbiology 2022Quote: ... was performed using specific primers containing a 5’ T7 promotor sequence adapted to both forward and reverse primers and Taq polymerase (NEB). PCR products were purified using the GeneJET PCR Purification kit (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...
-
bioRxiv - Genetics 2022Quote: ... was assessed via PCR amplification using OneTaq 2x Master Mix (forward primer DLO1142 5’-ACCCATTTCCCATTCAATCA-3’ reverse primer DLO1143 5’-TTGTAATCTGCCCCAAAAGG-3’) and subsequent HpaII restriction digest (New England Biolabs). DLW135 carried a wild type allele of pho-9 ...
-
bioRxiv - Microbiology 2021Quote: ... and TMPRSS2 (Forward Primer: CAAGTGCTCCRACTCTGGGAT, Reverse Primer: AACACACCGRTTCTCGTCCTC) were quantified using the Luna Universal qPCR Master Mix (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The anchor sequence was added to the 5’ end of the transcript by PCR amplification using the gene-specific reverse primer PK13 and the oligo(dT)-anchor primer and Phusion High-Fidelity DNA Polymerase (New England Biolabs). PCR products were analysed on agarose gels and purified using the QIAquick PCR purification Kit according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was instead PCR amplified from pGADCg using forward primer AP36 and reverse primer AP38 (5’ GCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGcatctattgaagtaat aataggcgcatg 3’) and cloned into NotI- and XmaI-digested (NEB) pDest-AD-QZ213 via homologous recombination in yeast ...
-
bioRxiv - Genetics 2020Quote: ... followed by Sanger sequencing using shani F2 primer (oligonucleotide primer sequences are provided in Table S2) or by digestion of the amplified product with MnlI (NEB) or BstNI (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... followed by DNA amplification by multiplex PCR in two separated primer pools using ARTIC-N5 primers (59, 60) and Q5 Hot Start DNA polymerase (New England BioLabs). The DNA libraries for Illumina NGS were prepared from pooled amplicons using the QIAseq FX DNA Library Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1.25 uL 10uM SR primer (from NEB E7330L), 1.25 uL 10uM index 3 primers ...
-
bioRxiv - Biochemistry 2021Quote: ... and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... then primers and 2x NEBNext Master Mix (NEB) was added for direct amplification with the following conditions ...
-
bioRxiv - Bioengineering 2019Quote: ... and an Index (X) primer (New England Biolabs). Products were purified (AMPure XP ...
-
bioRxiv - Microbiology 2019Quote: ... Dual Index Primers (New England BioLabs, catalog #: E7600), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.25 μl SR primer for Illumina (NEB-kit), 2.5 μl nuclease-free H2O ...
-
bioRxiv - Molecular Biology 2020Quote: ... with index primers (NEB, E7335, E7710 and E7600). Fragmented genomic DNA from S ...
-
bioRxiv - Bioengineering 2021Quote: NEBNext i5 indexed primers (NEB, E7600 and E7645) were used as opposed to the non-indexed P5NEXTPT5 primer during library PCR and indexing step to generate dual indexed libraries for multiplexing
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL 10 μM NEBNext Index Primer (NEB E7335 ...
-
bioRxiv - Cell Biology 2019Quote: ... reactions using Random Primer 9 (New England Biolabs).
-
bioRxiv - Developmental Biology 2019Quote: ... primer extension was performed using Phusion polymerase (NEB) of forward primer 5’-GAAATTAATACGACTCACTATAGG-N20-GTTTTAGAGCTAGAAATAGC-3’ (including a 20 nt target site ...
-
bioRxiv - Systems Biology 2021Quote: ... the primers were digested by exonuclease I (NEB) and the DNA was purified using Agencourt Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and random primer mix (New England BioLabs, S1330S) according to the typical cDNA synthesis protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... primers were designed with NEBuilder Assembly Tool (NEB) as listed in table 1 to generate PCR products from NLS-mNeptune2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and index primers (E7335/E7500/E7710/E7730, NEB) before 37 bp paired-end sequencing using the NextSeq 500 device (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... a different EM-Seq Index Primer (NEB, E7120S) was added to each sample and 4 cycles were used ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Library Quant Primer Mix (NEB, E7603) for sequencing following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and random 9-mer primers (New England Biolabs). Quantitative reverse transcriptase–PCR was performed using SYBR Green Master Mix (Roche ...
-
bioRxiv - Physiology 2023Quote: ... Primers were designed using the NEBuilder tool (NEB), inserts were synthesized as gBlocks and purchased from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Microbiology 2023Quote: ... using primers designed with NEBaseChanger (New England Biolabs). Whole plasmids were confirmed by Oxford Nanopore sequencing (Plasmidsaurus ...
-
bioRxiv - Neuroscience 2023Quote: ... primers were designed using NEBuilder (New England BioLabs). All plasmids were confirmed by whole-plasmid sequencing (Primordium Labs).
-
bioRxiv - Cancer Biology 2023Quote: ... Unique dual index primer pairs (New England Biolabs) were used to barcode single-cell libraries ...
-
bioRxiv - Microbiology 2023Quote: ... Gibson assembly primers were designed using NEBBuilder (NEB) and restriction digestion and DNA ligation was performed using enzymes supplied by NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Unique dual index primer pairs (New England Biolabs) were used to barcode single -cell libraries ...
-
bioRxiv - Immunology 2024Quote: ... Primers were designed using the NEBaseChanger tool (NEB) and are shown in Supplemental Table 1 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and RT-qPCR was performed using the Luna Universal Onestep RT-qPCR kit (New England Biolabs, Ipswich, Massachusetts, USA) on a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (M300, New England Biolabs). The samples were analyzed using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed in 384 well format with Luna Universal Probe One-Step RT-qPCR Kit (NEB), assaying Fluc (primers oHR711/712 ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCR was conducted in technical triplicate using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer’s instructions in 10 µl reaction volumes and reactions were run on a CFX Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2023Quote: ... and the RT-qPCR master mix prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs), as per the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10 µL RT mix (5 µL 5x Maxima RT Buffer, 1.25 µL 10 mM/each dNTP [New England Biolabs #N0447S] ...
-
bioRxiv - Genomics 2021Quote: ... in combination with NEBNext Multiplex Oligos for Illumina Set 1 (NEB#E7335), ribosomal RNA depletion was performed using 1 μg RNA using NEBNext rRNA Depletion kit (NEB#6310) ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR reactions were set up using Luna Universal qPCR Master Mix (NEB) following the manufacturer's protocol ...
-
bioRxiv - Genomics 2022Quote: NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (E6240L, NEB)
-
bioRxiv - Genomics 2022Quote: ... using NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (NEB) and NEBNext Ultra DNA Library Prep Kit for Illumina (NEB ...