Labshake search
Citations for New England Biolabs :
7751 - 7781 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: 1 µg of total RNA was used to perform mRNA isolation using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB Cat. No. E7490). The resulting mRNA material was used to prepare the libraries with the use of NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit). Paired-end 2×25 bp sequencing was performed on a NextSeq500 Illumina Sequencer.
-
bioRxiv - Cancer Biology 2023Quote: ... The sequencing libraries were prepared following Chapter 1 of the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England BioLabs, NEB) protocol ...
-
bioRxiv - Genomics 2023Quote: ... We then ligated barcodes to the end-prepped DNA using the Native Barcoding Expansion 1–12 kit (EXP-NBD104, Oxford Nanopore Technologies, Oxford, UK) and Blunt/TA Ligase Master Mix (New England Biolabs, Ipswich, MA, USA). We cleaned the barcoded samples using 0.9X AMPure XP beads ...
-
bioRxiv - Genomics 2023Quote: ... using the Adapter Mix II from the Native Barcoding Expansion 1–12 kit and NEBNext Quick Ligation Reaction Buffer (New England Biolabs, Ipswich, MA, USA) as well as Quick T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... along with a well containing 10 µl Quick-Load® Purple 1 kb DNA Ladder (New England Biolabs catalog no. N0552S; New England BioLabs, Ipswich, MA) and ran at 105 V for 45 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... F: agaagtcttagcatatgtggtac R: aacagatgttggacccttcc RNA diluted at 1/100 was amplified using Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, MA) according to the manufacturer’s directions on a QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of the supernatant was used as template for PCR using the Q5® High-Fidelity 2X Master Mix (NEB, Cat. # M0492L) and the primer pair prCP222-prCP223 to amplify FCY1 (Table S2) ...
-
bioRxiv - Plant Biology 2024Quote: ... to create a level-1 plasmid by cut and ligate reaction using BsaI restriction enzyme and T4 DNA ligase from NEB (New England Biosciences). All plasmids were confirmed by restriction digestion and DNA sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... was used to do the library according to the manufacturer protocol with the following index set NEBNext Multiplex Oligos for Illumina (Dual-Index Primers Set 1; NEB, cat. no. E7600S) and sequenced on AVT system.
-
bioRxiv - Biochemistry 2022Quote: For crystallization the Ioc4 PWWP domain (aa 1-178; Ioc4PWWP) was cloned into a modified pMAL-c2X vector (New England Biolabs, Liu et al., 2001) in order to produce a fusion protein with an N-terminal maltose-binding protein (MBP) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL annealed stem-loop oligonucleotide was mixed with 1 μL pre-linearized vector and ligated with T4 DNA ligase (cat. no. M0202, New England BioLabs, Inc., Ipswich, MA, USA), according to vendor’s ligation protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... and annealed (denaturation at 95°C for 5 min and then slow cooling of the samples at the rate of -2°C/sec from 95°C to 85°C and then - 0.1°C/sec from 85°C to 25°C for annealing of heteroduplexes) before addition of T7 Endonuclease I (NEB, Ipswich, Massachusetts, USA, M0302S). Heteroduplexes containing small mutations at the intended site should be cleaved into two fragments ...
-
bioRxiv - Biochemistry 2021Quote: ... according to the LAMP method described earlier with additions to the earlier described CRISPR Mix (Modification: 1 μL NTP Buffer Mix (From NEB #E2050, no additional MgCl).
-
bioRxiv - Systems Biology 2021Quote: ... Libraries were prepared from 1 μg of total RNA using NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) by poly(A ...
-
bioRxiv - Molecular Biology 2021Quote: ... The gene fragment was amplified from approximately 30ng of DNA in each sample (primers in Supplementary Table 1) using a high-fidelity polymerase (NEB Q5, New England Biolabs)[27] and confirmed by 1% agarose gel electrophoresis ...
-
bioRxiv - Bioengineering 2022Quote: ... Processing the samples for proteomics was then continued using a 10 kDa filter aided sample preparation protocol previously published with minor modifications.[30] The proteins were digested using Lys-C enzyme (P8109S, New England Biolabs, MA, USA; 1:50) and then with trypsin (V5111 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... leprae positive faecal and necropsy samples (Supplementary Information Table 1) were converted into dual-indexed libraries using the NEBNext® Ultra™ II DNA Library Prep kit (New England Biolabs, MA, USA)57,58 ...
-
bioRxiv - Genomics 2020Quote: PCR products were loaded into a single lane on a 1% agarose gel with 100 bp DNA ladder (New England Biolabs, Frankfurt am Main, Germany). Fragments between 200 and 500 bp were cut from the gel with a scalpel and purified using the QIAquick gel extraction kit (QIAgen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reversely transcribed into cDNA from 1 μg of mRNA template using the M-MuLV cDNA Synthesis Kit (New England Biolabs, Frankfurt am Main, Germany) according to the protocol of the manufacturer ...
-
bioRxiv - Plant Biology 2022Quote: ... The precipitates and one-fifth of the supernatant were boiled in SDS loading buffer and subjected to western blot analysis using an anti-MBP monoclonal antibody (New England Biolabs, E8032S, 1:200 dilution), followed by anti-mouse IgG-HRP (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequencing libraries were generated from 1 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sequencing libraries were generated from 1 µg total RNA per sample using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2024Quote: ... gDNA was extracted using full B2M locus primers (Supplement Table 1) and amplified with Q5® Hot Start 2x Master Mix (New England Biolabs, Ipswich, Massachusetts, US). The target DNA was purified by PureLink® PCR cleanup (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sequencing libraries were prepared following Chapter 1 of the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England BioLabs, NEB) protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® and the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, New England Biolabs, Ipswich, Massachusetts, USA) and following the manufacturer protocol ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was subjected to end-repair in the same reaction by adding 1 μl of Klenow fragment (New England Biolabs cat. M0210S, 5000 U/ml) and 1 μl of dNTP mix (10 mM dA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein amounts of OP18 and beta-actin were quantified using a primary stathmin polyclonal antibody (1:1000; Cell Signaling Technology, NEB GmbH, Frankfurt/Main, Germany) and a polyclonal beta-actin antibody (1:1000 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The first cDNA synthesis was initiated by adding 1 U/µL RT at final concentration (NEB #M0277L for AMV RT, NEB #M0368L for ProtoScript II RT, and NEB #M0253L for M-MuLV RT). After 20 minutes of incubation at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Cell pellets from three 10 cm plates were pooled together and lysed in 1 mL of NP40 buffer (supplemented with cOmplete™ Mini protease inhibitor, 1mM PMSF, NEB Murine RNase inhibitor and RNaseIN) by incubating at 4 °C for 30 min with occasional pipetting to mix ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in 20 µl reactions and products were run on a 1% agarose gel alongside an appropriately sized ladder (either New England Biolabs 100 bp or 1kb DNA ladder) and stained post-electrophoresis with GelRed® (Biotium) ...