Labshake search
Citations for New England Biolabs :
7351 - 7400 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng of Cy5-labeled and biotinylated DNA was incubated with 1 μg of streptavidin (SA, New England Biolabs, #N7021) in 25 μL of binding buffer (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2023Quote: ... and ΔpreNAC (a.a. 1−36+61−140)) were introduced using the Site-Directed Mutagenesis kit (New England Biolabs, MA, USA). The complete sequences of all recombinant protein constructs used in this study are listed in the Supplementary Information (“Protein construction and sequence” section) ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...
-
bioRxiv - Immunology 2023Quote: A-pixels were degraded by incubating the cells in a 50 μl reaction containing 1 U USER enzyme (New England Biolabs) in Wash Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Barcodes from the Native Barcoding Expansion 1-12 & 13-24 from ONT were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA was purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... And 1 µg of the total RNA was reverse transcribed into cDNA using Luna script RT Supermix (New England Biolabs) as per the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL lysate was used as a template for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Pathology 2023Quote: ... cDNA library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs). cDNA libraries were sequenced by NovaSeq 6000 (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... The fragments were inserted within the EcoRV site of the Tol1-based transgenesis vector pDon122 (Cosmo Bio, CSR-CT-NU-002-1) using the NEBuilder HiFi DNA Assembly System (New England Biolabs). The Tol1-based transgenic construct (5 ng/µL ...
-
bioRxiv - Physiology 2023Quote: ... was obtained by reverse transcription (RT) using 1 μg of RNA and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (M0253, NEB), using the first strand cDNA synthesis standard protocol with random primers (S1330 ...
-
bioRxiv - Microbiology 2023Quote: ... 50 pmol of each RNA were dephosphorylated by incubation for 1 h at 37°C with 25 U of calf intestine alkaline phosphatase (NEB) in a final volume of 50 µL ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lysate obtained from lysis with 1% NP-40 lysis buffer phosphatase inhibitor were mixed with lambda phosphatase (New England Biolabs) and incubated at 30°C for 2 hours ...
-
bioRxiv - Microbiology 2022Quote: ... shRNA oligos targeting ORF45 listed in Table 1 were then annealed and ligated into the vector using T4 DNA ligase (New England Biolabs) and transformed into Escherichia coli XL-1 Blue cells ...
-
bioRxiv - Molecular Biology 2022Quote: Crushed lungs were homogenized using a mechanical homogenizer (Omni International, Waterbury CT) or cultured cells were lysed in 1× lysis buffer (9803S, NEB) (20 mM Tris-HCl buffer (pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: PCR-generated fragments of the CNX1 and CNX2 genomic regions lacking stop codons and including the 1-kbp promoter regions were obtained using Phusion HF DNA polymerase (New England Biolabs), inserted into pENTR-2B ...
-
bioRxiv - Molecular Biology 2024Quote: ... To do this 2.5 uL of cutsmart buffer was added to 20 uL of purified PCR product and then 1 uL of DpnI (NEB) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... gondii total RNA was ligated to a small RNA oligo (Rumsh, see Table S9) using T4 RNA Ligase 1 (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... before ligation to microsatellite expansion adapters containing an EcoRV restriction site (listed in Supplemental Table 1) using the T4 DNA Ligase Kit (NEB) at a 5:1 ratio overnight at 16°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pSpy0K6 and p7INT.1 was extracted using the Monarch® HMW DNA Extraction Kit for Tissue (New England Biolabs®) according to the manufacturers protocol for Gram-positive bacteria (low input ...
-
bioRxiv - Microbiology 2024Quote: ... an inverse PCR was performed using R3-p21 and the oligonucleotides ToANV-rectest-For/ToANV-rectest-Rev (Supplementary Table 1) using Phusion High-Fidelity DNA Polymerase (New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The HIV-1AC-1 mutations were introduced into WT and N74D pNLdE-luc using the Gibson Assembly Cloning kit (New England Biolabs) and primers shown in Table S1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.5% (vol/vol) Triton X-100 in nuclease-free water and 1% (vol/vol) proteinase K (New England Biolabs, P8107S). The sample was digested in this buffer for ≥36h in a humidified ...
-
bioRxiv - Immunology 2024Quote: ... To subclone this pool we digested our protospacer-empty Libr.1-null transfer vector with BsmBI-v2 (New England Biolabs, NEB) overnight at 55 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... DIG- and FITC-labeled antisense RNA probes were generated from 1 µg of linearized plasmid template using T7 or Sp6 RNA polymerases (NEB) and DIG-11-UTP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of total RNA was used for standard library preparation using NEBNext PolyA mRNA magnetic isolation module (NEB, E7490). In brief ...
-
bioRxiv - Cell Biology 2023Quote: ... the KCNJ16 gene was amplified with 1× Q5 Hot Start High-Fidelity master mix (New England Biolabs, Ipswich, United Kingdom), 0.5 μM forward primer (‘5-‘3 CTACCCGCCAGAGCACATTAT ...
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs). The genomic region surrounding the spo11uc73allele was amplified for 35 cycles with an annealing temperature of 57°C and products were resolved without digestion48 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Probes were hybridised in FISH hybridization buffer (50% formamide, 20% dextran sulfate, 2X SSC, 1 μg/μL BSA (New England Biolabs), 10 mM vanadyl-ribonucleoside complex ...
-
bioRxiv - Cell Biology 2024Quote: THP-1 monocytes were harvested and lysed for RNA extraction using the Monarch Total RNA Miniprep kit (New England Biolabs), according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... a five-fold molar excess of oligonucleotides bearing either 8-oxo-G or G was mixed with the phage-extracted circular single-stranded DNA in 1=×=Phusion HF Buffer (New England BioLabs). After denaturation at 90=°C for 2=min followed by rapid cooling ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL resuspended plaque were used for each PCR in 10 µL scale in the presence of 1 x High Fidelity PCR Master Mix (NEB) and 500 nM NudE.1 fwd and rev screening primer (Supplementary Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... and used as a template for barcode amplification in a 1-step PCR with Q5 polymerase with high-GC buffer (NEB). Indexed samples were sequenced on a NextSeq 550 in high-output mode (Donnelly Centre ...
-
bioRxiv - Biochemistry 2024Quote: ... 3’ adapters with 5’-adenylated RNA adapter (see 3’ adapters in table below) were ligated to the recovered small RNAs using Rnl2(1-249)K227Q RNA ligase (M0351, New England Biolabs) according to the manufacturer’s instructions at 4°C overnight with shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 200 µM ATP with ot without 1 µl of recombinant PKA catalytic subunit (PKAc; New England Biolabs) in manufacturer-supplied reaction buffer at 30° C for 30min with agitation ...
-
bioRxiv - Genomics 2023Quote: The circularized cDNA (1 µL) was amplified by PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB M0494L) in a 25 µL reaction containing 12.5 pmoles of forward and reverse primers (primers listed in Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... TIS11B protein-RNA complexes were immunoprecipitated from 1 ml of crosslinked lysate and washed with high salt and PNK buffer (NEB). RNA was repaired by 3′ dephosphorylation and ligated to L3-IR adaptor on beads ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% sodium dodecyl sulfate) and reverse crosslinked with proteinase K overnight at 65C and subsequently treated with RNAse A (NEB) for 1 hour at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Purified digested vector and inserts were ligated in a 1:30 vector/insert ratio using the T4 DNA ligase (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were generated from 1 μg DNA per sample using the NEBNext Ultra DNA Library Prep Kit (NEB #E7645, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Fragments were then assembled into a single tln-1 gDNA clone in a pCR8 vector using HiFi DNA assembly (NEB). Using gateway technology (LR clonase II ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were then mixed with 350 μl 1× RNA protection reagent and RNA was purified using a Monarch total RNA extraction kit (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... genomic loci were amplified in a first PCR reaction (PCR-1) reaction from approximately 100 ng of gDNA using Q5 High-fidelity DNA Polymerase (NEB) and the primers listed in Sup ...
-
bioRxiv - Biochemistry 2023Quote: ... 30 ng pT-plasmid either carrying the blasticidin or the puromycin resistance marker and 1 unit HIFI Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer (05917131103 ...
-
bioRxiv - Genetics 2023Quote: ... 300 ng of PCR products were digested at 37° C for 1 hour with 10 units of MfeI-HF and SspI-HF in 1X rCutsmart buffer (New England Biolabs, cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were labelled both at the surface and intracellularly by addiction of the cell permeable SNAP-Cell 647 SiR ligand (1:1000, New England Biolabs) in DMEM F12 without serum and phenol red (21041-025 ...
-
bioRxiv - Cell Biology 2023Quote: ... Two 100 μl aliquots were incubated overnight at 37°C with and without 1 U Endo H (NEB, Frankfurt, Germany). Then the samples were heated with 100 μl SDS sample buffer for 5 min at 95°C.
-
bioRxiv - Molecular Biology 2023Quote: ... two independent 50 μL reactions with 1 μg of backbone plasmid were digested at 37 °C for 1 hour with MluI-HF and EcoRI-HF (New England Biolabs). After heat-inactivation (65 °C ...
-
bioRxiv - Biophysics 2023Quote: ... The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395) into a pACEBac1 vector via HIFI DNA assembly kit (NEB). All constructs were verified using whole plasmid sequencing from Plasmidsaurus.
-
bioRxiv - Microbiology 2023Quote: ... barcodes from the Native Barcoding Expansion 1-12 & 13-24 from Oxford Nanopore Technologies (ONT) were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA purifications were made using Ampure XP beads (Beckman Coulter) ...