Labshake search
Citations for New England Biolabs :
7601 - 7650 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Purified RNA was quantified by ultraviolet spectrophotometry and 1 μg used for reverse transcription by LunaScript® RT SuperMix Kit (New England Biolabs), as described by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... A polyadenylated fraction was purified from the total RNA (1 µg) using the NEBNext® Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). This fraction was used to construct cDNA library using a previously described method [91] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR reactions were performed with a final primer concentration of 1 mM using Q5® High-Fidelity 2X Master Mix (NEB). Equal volumes of X and Y PCR reactions were then combined ...
-
bioRxiv - Plant Biology 2022Quote: ... Double promoter constructs were constructed by reamplifying the promoter region of interest with unique overhangs and cloning into the Level −1 universal acceptor backbones using the BsaI-HFv2 restriction enzyme (#R3733L New England Biolabs, USA). These parts were then assembled into the same Promoter + 5’ UTR acceptor backbone using the BpiI restriction enzyme (#ER1012 Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: The starting library strand (50 pmol) and regeneration hairpin (75 pmol) (Supp. Table 1) were combined in a 1X ligation buffer (New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2023Quote: ... PCRs to confirm targeted and untargeted SMN2 loci were performed for each of the cell lines with primer pairs shown in table 1 using High-Fidelity 2X PCR Master Mix (NEB, M0541L) and Thermal Cycler C1000 Touch (Bio-RAD) ...
-
bioRxiv - Biochemistry 2023Quote: ... and ScFv16 at room temperature for two hours in the presence of 25 mU ml-1 apyrase (NEB, cat. no: M0398S) and either C3a or EP54 for complex formation ...
-
bioRxiv - Genomics 2023Quote: ... Chromatin was denatured with the restriction enzyme NlaIII at a final concentration of 1 U/μL (New England Biolabs, United Kingdom) at 37°C for 18 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... and a gBlock (purchased from Integrated DNA Technologies [IDT]) containing an anhydrotetracycline (aTc) inducible promoter (pLTetO-1) were inserted via HiFi Assembly (HiFi Assembly Kit (NEB#E5520S)) into a PCR-ed fragment of plasmid pBbA2c-RFP (Addgene #35326 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated in CO2-balanced pre-warmed media supplied with 1 µM O6-benzylguanine (BG)-coupled Alexa Fluor 647 (NEB, S9136S) for 15 min at 37°C in a 5% CO2 atmosphere ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCS2-dKif6 (1-501)-EGFP was generated from the pCS2-dKif6-EGFP plasmid by Gibson assembly (NEB HiFi DNA Assembly Kit) using a GeneArt gene fragment encoding amino acids 1-501 (Thermo Fisher).
-
bioRxiv - Cancer Biology 2022Quote: ... The pLentiCRISPRv2 plasmid was digested for 1 hr at 55°C with 1U per μg of DNA BsmBI-v2 (NEB, R0580), in 5 μl Buffer 3.1 and to a final volume of 50 μl ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: Purified DNA was amplified with human-or mouse-specific primers covering the RBM20 RS-domain mutation hotspot with Nextera-compatible adapters (Sup. Table 1) using Q5®Hot Start High-Fidelity 2X Master Mix (NEB). One microliter of a 1:100 dilution was used for a second PCR attaching sample-specific index barcodes (Nextera XT Index Kit v2 Set A ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated at 37°C for 20 min followed by dephosphorylation with 1 U Shrimp Alkaline Phosphatase (rSAP, New England Biolabs, #M0371S) and incubation for another 20 min ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... with or w/o 500 µM auxin and the same volume of 2x Monarch DNA/RNA Protection Reagent (NEB #T2011-1) was added before snap-freezing and storage at −80°C until RNA extraction.
-
bioRxiv - Microbiology 2024Quote: ... Rp6 was ligated to mono-phosphorylated transcripts at 37°C for 30 min by adding T4 RNA ligase 1 (#M0204, NEB, USA) with the buffer ...
-
bioRxiv - Microbiology 2024Quote: ... The pBAD33 plasmid harboring the stem structure of rrsH (corresponding to -131∼-102 and +1559∼+1589 relative to +1 of rrsH gene) under T7 promoter was linearized by digestion with XbaI (NEB, R0145).
-
bioRxiv - Genomics 2024Quote: ... 1 µg of genomic DNA was pooled with 1:20 dilutions of unmethylated lambda (1 µl of 0.1 ng/µl) and methylated pUC19 control DNA (1 ul of 0.005 ng/µl) from the EM-seq kit (E7120L; NEB, Ipswich, MA). Volumes were made up to 50 ul with 0.1x TE buffer (Sigma-Aldrich ...
-
bioRxiv - Genomics 2024Quote: ... Supplementary Table 1) using a modified protocol of the NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Biolabs, UK) (Supplementary Methods and Supplementary Table 18 ...
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... embryos were stained with ush Stellaris and lacZ Stellaris probes (Frampton et al., 2022) and nuclei were stained with DAPI (1:1000, NEB 4083). Samples were mounted in ProLong Diamond antifade mountant (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 1 µg of total RNA used for sequencing library construction with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). Raw FastQ files were mapped using Bbsplit from the Bbtools 39.01 suite against Mm10 and hg38 (31 ...
-
bioRxiv - Zoology 2024Quote: ... PCR products were electrophoresed and visualized on 1% agarose gels and then were cleaned using Exonuclease I and Shrimp alkaline Phosphatase (New England Biolabs Inc.). Both forward and reverse strands were sequenced using BigDye® Terminator v3.1 cycle sequencing kit ...
-
bioRxiv - Neuroscience 2024Quote: ... was added at 1:6 concentration to each sample and the Quick-Load® Purple 100 bp DNA Ladder (#N0551, NEB) was used as a size indicator ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads were washed thrice with 1× NEB CutSmart Buffer followed by dephosphorylation by using Quick CIP (New England Biolabs, cat # M0525S) and DNase I treatment at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the biotin-dNTPs were removed from unligated ends by resuspending the pellet in 100 μl of 1X NEB buffer #1 (NEB B7001S) and 5 U/μl exonuclease III (NEB M0206L ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligo pools were cloned into the vector at a 6:1 molar ratio by Gibson Assembly at 50°C for 30 minutes (NEB E2611). The plasmid pools were ethanol precipitated ...
-
bioRxiv - Neuroscience 2024Quote: ... 12 20-μL reactions of gibson assembly were performed for 1 hour at 50C using the HiFi DNA Assembly MasterMix (NEB, E2621), with each reaction containing 184.9 ng of SacII-digested plasmid and a 10-fold molar excess of PCR-amplified insert ...
-
bioRxiv - Genomics 2024Quote: ... Cells were resuspended in 2ml ligation buffer 1 (1460 µl water, 400 µl 10x T4 DNA ligase reaction buffer (NEB, B0202SVIAL), 100 µl T4 DNA ligase (NEB ...
-
bioRxiv - Genetics 2024Quote: ... and up to 1 μg was reverse transcribed to cDNA using the ProtoScript II First Strand cDNA Synthesis Kit (NEB, Cat.E6560) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The soluble fraction was collected by high-speed centrifugation at 12,000 x g for 1 hr and applied to an Amylose resin high-flow column (NEB Cat#E8022S). Unbound proteins were removed by washing with sonication buffer ...
-
bioRxiv - Microbiology 2024Quote: ... and sgRNAs were amplified using P5 primers with different numbers of stagger regions pooled together (for sequencing diversity) and P7 primers (Supplementary Data 1) with unique barcode sequences using Q5 High-Fidelity DNA Polymerase (New England Biolabs, #M0491) under the following PCR condition ...
-
bioRxiv - Microbiology 2024Quote: ... and sgRNAs were amplified using P5 primers with different numbers of stagger regions pooled together (for sequencing diversity) and P7 primers (Supplementary Data 1) with unique barcode sequences using Q5 High-Fidelity DNA Polymerase (New England Biolabs, #M0491) under the following PCR condition ...
-
bioRxiv - Genomics 2024Quote: ... NaCl 5M stock was added to reach 1 M final concentration along with 30 µl of Streptavidin magnetic beads (NEB # S1420S) for 2 hrs with end-over-end mixing at 4°C to capture biotinylated DNA fragments ...
-
bioRxiv - Biochemistry 2024Quote: ... was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB, M0264L) for ssDNA digestion at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... the genomic region (∼2000 bp) surrounding the natural start codon on exon 1 was cloned into the pUC19 vector (New England Biolabs, N3041S) by Gibson Assembly ...
-
bioRxiv - Microbiology 2024Quote: ... An enzymatic cleanup was done to remove primer dimers and inactivate nucleotides by directly adding 0.5µL of Antarctic phosphatase and Exonuclease 1 (New England Biolabs, Inc; M0293L, M0289L) and 1.22µL Antarctic phosphatase buffer (1x final concentration ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4x106 JM8+/+ and Bmal1-/- cells were fixed with formaldehyde 1% and digested overnight at 37°C using 400U of MboI (New England Biolabs, #R0147M). After filling with 50nM biotin-dATP (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ubl-1::mCherry::pri-mir-58-sensor-mut mutation was introduced into the CMP1 ubl-1::mCherry::pri-mir-58-sensor plasmid using NEB Q5 site directed mutagenesis (New England Biolabs, E0554S) with the primers GGGATGAGATTGTTCAGTACG and TATGGTATTGGACGAAGTG ...
-
bioRxiv - Molecular Biology 2024Quote: ... This incubation was repeated with a 1:200 pA-Dam solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps ...
-
bioRxiv - Biophysics 2024Quote: ... We mixed the digested handles with the large 38 kb fragment in 10:1 molar ratio (biotin-handles to DNAparS) and added T4 DNA ligase (New England Biolabs, M0202L) and 1 mM ATP for ligation ...
-
bioRxiv - Genomics 2024Quote: ... This incubation was repeated with a 1:200 pA-Dam solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps ...
-
bioRxiv - Genomics 2024Quote: ... approximately 1 μg of total RNA underwent rRNA depletion using the NEBNext rRNA Depletion Kit (NEB, Ipswich, MA, USA, Cat# E6318). RNA-seq libraries were then prepared following the whole transcriptome sequencing protocol of Novogene (https://www.novogene.com/us-en/resources/blog/a-basic-guide-to-rna-sequencing/) ...
-
bioRxiv - Biochemistry 2024Quote: ... the DNA digestion or cleavage activity of the proteins was performed by incubating 50 nM protein with 10 ng ml -1 pUC19 plasmid (NEB N3041S), in a 20 µl reaction at 37 °C for varying time conditions in 20 mM Hepes pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... This modified vector was digested at 37ºC for 1 hour and purified with Monarch® DNA Gel Extraction Kit (NEB #T1020).
-
bioRxiv - Biochemistry 2024Quote: ... A 1 kb DNA ladder (New England Bio Labs #N3232S) was mixed with Gel Loading Dye Purple 6X (New England Biolabs #B7024S) and water ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of RNA was converted to cDNA using the ProtoScript® II First Strand cDNA Synthesis Kit (New England BioLabs), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... and DNA templates and primers listed in Additional Table 1 and cloned into pH7WG plasmid linearized with SalI-HF (NEB, Cataog # R3138S) and AscI (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplification of the GC-rich region (primer 1) was performed with high fidelity Q5 polymerase (New England Biolabs Inc, Ipswich, MA) using the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... using the LTP library preparation kit and employing NEBNext multiplex oligos for Illumina index primer pairs set 1 (New England Biolabs, Ipswich, Massachusetts). Sequencing was performed using a NextSeq 500/550 mid-output v2.5 300 cycle cartridge (Illumina ...