Labshake search
Citations for New England Biolabs :
7451 - 7500 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of genomic DNA (∼100 ng) was mixed with 8 µl of 1x Cutsmart buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:10 and used for qPCR reactions employing Luna® Universal qPCR Master Mix (New England Biolabs). Ct values were computed by the instrument and used for calculation of ΔΔCt using ACTB (Beta-actin ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells or islets were incubated for 24 hours post-transfection / transduction before labelling with 1 µM SNAP-Surface fluorescent probes (New England Biolabs) for 15-20 minutes for cells ...
-
bioRxiv - Pathology 2024Quote: ... cDNA library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs). cDNA libraries were sequenced by NovaSeq 6000 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of genomic DNA (∼100 ng) was mixed with 8 µl of 1x Cutsmart buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Amplicons were analyzed by 1% agarose gel electrophoresis and purified according to the sizes using the DNA Gel Extraction Kit (NEB).
-
bioRxiv - Genetics 2024Quote: ... IVS5-IVS6) was amplified from genomic DNA isolated from Patient 1 using Q5 High-Fidelity DNA Polymerase (New England Biolabs) with 35 cycles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The first cDNA synthesis was initiated by adding 1 U/µL RT at final concentration (NEB #M0277L for AMV RT, NEB #M0368L for ProtoScript II RT ...
-
bioRxiv - Microbiology 2024Quote: ... All three libraries were rescued post-transformation by inoculation into 1 ml of SOC outgrowth medium (New England Biolabs, B9020S) pre-warmed to 37°C and incubated with aeration at 37°C for 1 hour.
-
bioRxiv - Neuroscience 2024Quote: ... 1 µL of both the strands at a concentration of 100 µM was added to 1 µL of T4 PNK (New England Biolabs), 1 µL of T4 ligation buffer and 6 µL of H2O ...
-
bioRxiv - Synthetic Biology 2024Quote: Plasmid DNA was pre-digested with the Not I enzyme in a reaction containing 1 μL of CutSmart buffer (NEB), 0.5 μL of NotI-HF enzyme (NEB) ...
-
bioRxiv - Systems Biology 2024Quote: ... Annealed oligos are diluted 1:20 with DNase free water and 1uL is used in a Hi-T4 (NEB, M2622S) ligation reaction at room temperature for 1 hour ...
-
bioRxiv - Synthetic Biology 2024Quote: Golden Gate cloning reactions were performed using forty fmol of plasmid parts in a reaction mix recipe of 1 µl restriction enzyme (BsmBI-v2, Esp3I, or BsaI-HF-v2) (New England Biolabs), 1.5 µl bovine serum albumin ...
-
bioRxiv - Microbiology 2024Quote: ... Laboratory vectors and plasmid constructs (Supplementary Table 1) were purified using the Monarch Plasmid Miniprep Kit (New England Biolabs, UK). DNA fragments for cloning were amplified using Q5 DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The purified HIV-1C T/F LTR PCR products were cloned into the linearized C731CC lentiviral vector by ligation using 1 U of T4 DNA ligase (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting RNA’s purity was assessed by NanoDrop and run on a 1% agarose 1X TBE gel using 2X RNA Loading Dye (New England Biolabs) and stained with 1µg/mL ethidium bromide ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µg of DNA origami nanoparticle was mixed with 1 U/µl DNase I (2,000 units/mL, New England Biolabs, M0303S) mixed with 10× DNase I buffer diluted in water (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: Nucleoside-modified mRNAs were produced from 1 μg of linearized template DNA using the HiScribe T7 mRNA Kit with CleanCap Reagent (New England Biolabs) according to manufacturer instructions with the following modifications ...
-
bioRxiv - Plant Biology 2024Quote: ... Annealing was performed with 1 µl of annealed sgRNA and 100 ng of linearized vector using T4 DNA Ligase (New England BioLabs). The ligation product was transformed in E ...
-
bioRxiv - Biochemistry 2024Quote: ... an aliquot of the dense DNA fraction of the second gradient was desalted and subsequently digested for 1 h at 37°C with single-strand-specific nuclease P1 and RNAseH (both New England Biolabs). Digestion-resistant DNA was purified by phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Genomics 2024Quote: ... The NNK ultramers and the replication oligo pool were extended in a 1-cycle PCR (Q5 high-fidelity DNA polymerase, NEB) with primers TSO_2 and TSO_65 (Supplementary Data File 5) ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of the 1:10 diluted adapter-ligated library aliquot were amplified in 10-µl reactions containing 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEB_mws20 primer (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T (IDT) ...
-
bioRxiv - Genomics 2024Quote: ... PCR that was performed in 60 µl reactions as follows: 20 µl purified library was amplified with 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEBNext Multiplex Oligos for Illumina (Index Primers Sets 1-4) ...
-
bioRxiv - Neuroscience 2024Quote: ... and pre-amplified for 14 cycles against a pool of primers (Extended Data Table 1) using PreAmp Grandmaster mix (TATAA Biocenter) before exonuclease I treatment (NEB). Pre-amplified cDNA was diluted at least five-fold with nuclease-free water and mixed with SsoFast EvaGreen with Low ROX (BioRad ...
-
bioRxiv - Genomics 2024Quote: ... Δ([fimB or yjiT]-opgB)114::IS10 Δ(dcm::FRT1)1) and the dcm+ (DHB4, GenBank accession: CP014270.1) genomic DNA were obtained from NEB. The m4C containing genomic DNA from Natrinema pallidum BOL6-1 archaea was also obtained from NEB.
-
The ATP-dependent protease ClpYQ degrades cell division proteins DivIVA and Mbl in Bacillus subtilisbioRxiv - Biochemistry 2024Quote: ... Reaction mixtures were prepared with a 25 μL final volume and contained 1 X Φ29 DNA polymerase reaction buffer (NEB), 0.1 mg/mL recombinant albumin (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... The HT-PAMDA substrate libraries containing the four control plasmids (combined at a ratio a 1:100 control plasmid pool to HT-PAMDA library) were linearized with PvuI-HF (NEB) before performing HT-PAMDA previously described18,37.
-
bioRxiv - Biochemistry 2024Quote: Transgene template RNAs and mRNAs for cellular transfection were made using 1 ug of plamid fully linearized with BbsI (NEB) for 4 h at 37 °C and purified with PCR purification kit (QIAGEN ...
-
Single-molecule analysis reveals the mechanism of chromatin ubiquitylation by variant PRC1 complexesbioRxiv - Biophysics 2024Quote: ... a 5-10 fold excess of the annealed and labeled chromatin anchor was added to 130 µg of BsaI-digested chromatin DNA in 400 µl of 1× T4 ligation buffer along with 50 units of T4 ligase (NEB) per 1ug of chromatin DNA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 µL of reaction mixture containing 1 µg of template was prepared for in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and incubated overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... A plasmid expressing HIV-1 Gag with an internal EGFP tag was generated using the NEB HiFi Assembly Kit (New England Biolabs). A lentiviral backbone containing a tetracycline-inducible promoter and a gene encoding rtTA was prepared by digesting the pCW57.1 plasmid (Addgene #41393 ...
-
bioRxiv - Bioengineering 2024Quote: ... cleanup was performed before dA tailing using Taq polymerase (34 μL eluate, 1 μL 10 mM dNTP mix (NEB, N0447S), 1 μL Taq polymerase (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL of linearised backbone and 1 µL digested pMB.BIG1a-e mix were used to set up a 20 µL Gibson Assembly (NEB #E2611) reaction ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA pellet was resuspended in 50 μL of TE buffer and 1 μL was used in qPCR reaction with Luna qPCR Master Mix (New England Biolabs).
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was then diluted 1:4 to a total volume of 20 μL and 1 μL was used as template for qPCR with the Luna qPCR Master Mix (New England Biolabs) in a total reaction volume of 10 μL ...
-
bioRxiv - Cell Biology 2024Quote: ... total RNA-seq libraries were generated using the NEBNext Ultra II Directional RNA Library prep kit for Illumina with multiplex oligos set 1 (NEB) (GEO ...
-
bioRxiv - Biochemistry 2024Quote: ... 2:1 molar ratio of trimerization domain:plasmid were ligated at 37°C for 20 minutes in a 10 µl mixture reaction containing: 1 μL T4 ligase buffer (NEB), 0.5 μL PaqCI (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... Apoptotic cells were generated by supplementing cell culture with 10 µM staurosporine (Cayman) to induce apoptosis74 and 1 unit/mL DNAse I (New England Biolabs) to prevent cells from clumping ...
-
bioRxiv - Cell Biology 2024Quote: ... The coding sequence of Histone 1 fused to Maroon1 from pLL3.7m-mTurquoise2-SLBP was eliminated by excision of the vector with EcoRI-HF (NEB, R3101S). After gel purification using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: The pre-miRNA sequences were cloned and inserted into the MCS of the pLKO.1 vector (Adgene) by double digestion with Age-I (NEB) and EcoR-I (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... To insert the hU6 promoter and shRNA in pPBCAG-mCherry-CAAX a DNA fragment containing hU6 and shRNA was amplified from pLKO.1-shRNA using Phusion High-Fidelity DNA Polymerase (NEB) with primers that introduced SpeI restriction sites (Forward Primer ...
-
bioRxiv - Genetics 2024Quote: ... The target locus was amplified by PCR using locus-specific primers (Supplementary Table 1) with Q5 High-Fidelity DNA Polymerase (NEw England Biolabs) and no more than 30 PCR cycles under standard conditions ...
-
bioRxiv - Genomics 2024Quote: ... or NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1; New England Biolabs; Cat. No. E7416) with 14 cycles of enrichment PCR ...
-
bioRxiv - Microbiology 2020Quote: ... was in-vitro transcribed from 1 μg of these templates using the HiScribe T7 High Yield RNA synthesis kit (NEB, E2040S). Reactions were incubated at 37°C for 4 hours and run on a 6% TBE-Urea gel (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... libraries were prepared using the NEB Ultra II Library Preparation Kit and NEBNext® Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England BioLabs). The generation of the libraries followed manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 1μl XhoI digestion mix consisting of 5U XhoI restriction enzyme and 1 x NEB buffer 2.1 (New England Biolabs, Ipswich, Massachusetts), and 10 ng genomic DNA for iciHHV-6B samples or 200 ng DNA for non-iciHHV-6B samples.
-
bioRxiv - Evolutionary Biology 2021Quote: ... We isolated poly-adenylated RNA from 1 ug of total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and constructed sequencing libraries with the NEBNext Ultra II RNA Library Prep kit (NEB #E7770 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The mutant her9 allele carrying a 1 bp insertion was identified by RFLP due to the introduction of a BfaI restriction site (NEB: R0568S). Genomic DNA from whole embryos or from tail clips was extracted and amplified by PCR as described above ...
-
bioRxiv - Developmental Biology 2020Quote: The mutant her9 allele carrying a 1 bp deletion was identified by RFLP analysis due to the introduction of a BsaJI restriction site (NEB: R0563S). The mutant her9 allele carrying a 1 bp insertion was identified by RFLP due to the introduction of a BfaI restriction site (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and 0.4 μl of 20 mg/ml BSA with 1 μl (10 U/μl) of T4 endonuclease V (NEB, T4-PDG) and 1 μl (10 U/μl ...