Labshake search
Citations for New England Biolabs :
701 - 750 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and RT‒qPCR was performed using Luna Universal qPCR Master Mix (New England Biolabs, New England Biolabs, Ipswich, MA, USA) and CFX96 (Bio-Rad ...
-
bioRxiv - Systems Biology 2024Quote: ... 1µl of the reverse transcribed cDNA was used in each reaction for qPCR using the Luna Universal qPCR Master Mix (NEB) in a 10µl final reaction in a 384 well plate ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized from 500ng RNA using a Multiscribe High Capacity cDNA Synthesis kit (Thermo) and qPCR was performed using Luna qPCR Master Mix (New England Biolabs) against primers listed in table 2.
-
bioRxiv - Molecular Biology 2021Quote: ... two independent amplicons were generated by PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB). One amplicon for the targeted locus and one amplicon of the pegRNA locus (primers listed in Supplementary Table 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Final library for paired-end sequencing was prepared using NEBNext High-Fidelity 2X PCR Master Mix (NEB). PCR reaction ...
-
bioRxiv - Developmental Biology 2020Quote: ... Final library for paired-end sequencing was prepared using NEBNext High-Fidelity 2X PCR Master Mix (NEB) and a nested PCR approach as described in Schwartzman et al ...
-
bioRxiv - Bioengineering 2019Quote: ... All PCR amplifications were performed using Q5 Hot Start High-Fidelity 2X Master Mix (NEB, Cat: M0494S) unless specified ...
-
bioRxiv - Immunology 2020Quote: ... Single colonies were inoculated directly into a OneTaq Hot Start Quick-Load 2X Master Mix (NEB # M0488) with primers pSB_EF1a_seq.FOR (atcttggttcattctcaagcctcag ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Individual parts were ordered as gBlocks (IDT) or PCR amplified (NEB Q5 High-Fidelity 2x Master Mix). PCR products were purified with a GeneJET PCR Purification Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... RT-PCR was performed in a 50 µl reaction mixture with One Taq 2x master mix (NEB), 20 ng of cDNA and 0.2 µM of each primer (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: PCR amplifications were performed using OneTaq Quick-Load 2X Master Mix (New England BioLabs, Ipswich, MA, USA), 200 nM of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 µl of Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA), 0.625 µl of 4X Quant-iT PicoGreen dsDNA assay reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR was performed using a Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and the cycling conditions were ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA sequences were then PCR-amplified using Q5 Hot Start High-Fidelity 2X Master Mix (M0494, NEB), barcoded primer pairs (see Supplemental Table 2 ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification was performed using the Q5® Hot Start High-Fidelity 2X Master Mix (NEB, M0494) following the protocol provided by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... Subsequent on-bead PCR indexing-amplification of tagmented DNA was performed using 2x Phusion Master Mix (NEB) and custom-ordered indexing primers (IDT ...
-
bioRxiv - Genomics 2022Quote: ... All PCR reactions were performed using Q5® Hot Start High-Fidelity 2X Master Mix (NEB, M0494S). The in vitro transcription of VRQR-ABE7.10max mRNA reaction contains 50 ng/μL linearized VRQRABE-mRNA DNA template ...
-
bioRxiv - Bioengineering 2020Quote: ... SARS-CoV-2 S was amplified by PCR (Q5 High-Fidelity 2X Master Mix, New England Biolabs) from pUC57-nCoV-S (kind gift from Jonathan Abraham lab) ...
-
bioRxiv - Systems Biology 2020Quote: SARS-CoV-2 S was amplified by PCR (Q5 High-Fidelity 2X Master Mix, New England Biolabs) from pUC57-nCoV-S (gift of Jonathan Abraham) ...
-
bioRxiv - Immunology 2020Quote: ... and then Illumina barcoded and amplified with NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs). A portion of the reaction was performed as a separate qPCR reaction to determine ideal cycle number ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformants were screened by colony PCR using OneTaq 2x Master Mix (New England Biolabs, Ipswich, MA, USA). Production plasmids were isolated and analyzed by PCR and Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2019Quote: ... Regular PCR analysis was performed using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs) and detected by the T100™ Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1X OneTaq® Quick-Load® 2X Master Mix with Standard Buffer (New England BioLabs Inc., M0486L), and 2 μl of water suspended colony ...
-
bioRxiv - Genomics 2021Quote: ... 25 ul PCR reactions were prepared with LongAmp Taq 2x Master Mix (New England Biolabs, Inc; M0287L) and 0.4 uM of each primer ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments were enriched by PCR using Q5 High-Fidelity 2X Master Mix (New England Biolabs, #M0492S) and sequenced by the Illumina NextSeq 500 system in the Genomics Facility Basel ...
-
bioRxiv - Genetics 2020Quote: ... Each well contained 50 μL of NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs, M0541), 0.5 μL of each primer at 100 μM ...
-
bioRxiv - Microbiology 2022Quote: ... The DNA was then amplified with Quick-Load Taq 2X Master Mix (New England BioLabs, Ipswich, MA) and universal bacterial 8 F/1492 R primers ...
-
bioRxiv - Microbiology 2023Quote: ... 12.5 µl of One Taq Quick-load 2x master mix with standard buffer (New England BioLabs, UK) was aliquoted into a DNase-free 0.2ml transparent PCR tube ...
-
bioRxiv - Microbiology 2022Quote: All fragments for cloning were amplified using Q5 polymerase 2X master mix (New England Biolabs, Ipswich, Ma), and run on a 1% agarose gel with ethidium bromide ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DNA amplification for plasmid construction was performed using Q5 Hot Start High-Fidelity 2x Master Mix (NEB), and colony PCR was performed using Phire Green Hot Start II PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... PCR reactions were performed using OneTaq Quick Load 2X Master Mix with Standard Buffer (New England Biolabs). Detection of Mincle-specific cDNA was conducted by PCR with the same gene-specific primers described in the previous section (Suppl ...
-
bioRxiv - Developmental Biology 2023Quote: ... libraries were generated by PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) and purified using Agencourt AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... then amplified by performing 20 cycles of PCR using Q5® High-Fidelity 2X Master Mix (NEB) (final concentration between 30-100 ng.µl-1) ...
-
bioRxiv - Cell Biology 2023Quote: ... Synthesized testis cDNAs were used for endpoint PCR or quantitative PCR using OneTaq 2X Master Mix (NEB) or with iTaq Universal SYBR Green Supermix (BIO-RAD) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR was performed using OneTaq Quick-Load 2X Master Mix with Standard Buffer (New England Biolabs, USA). DNA assembly was done by using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... The purified DNA was amplified using a reaction mixture containing 2X NEB PCR Master Mix (NEB M0541L), a universal forward primer i5 ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified in PCR using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) using primers flanked with SfiI restriction enzyme recognition sequence (underlined ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: PCRs were performed with the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs M0494S) and primers outlined in Table S1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... containing 12·5 μL of Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs, M0494S), 1·1 μL of 10 μM SARS-Cov2-Midnight-1200 primer (either Pool 1 or Pool 2)(17 ...
-
bioRxiv - Genetics 2023Quote: ... and amplified for 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs; M0541L). After evaluation by real-time PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers were used in a polymerase chain reaction (PCR) with 2X Phusion Master Mix (New England Biolabs) and the appropriate parent plasmid ...
-
bioRxiv - Synthetic Biology 2023Quote: We amplified the oligonucleotide pool using either Phusion Hot Start Flex 2X Master Mix (New England Biolabs) or KAPA HiFi HotStart ReadyMix (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... were used to perform PCR on the single strand cDNA with OneTaq 2X Master Mix (NEB, M0482S) in 50 μL reactions with a touchdown PCR program ...
-
bioRxiv - Neuroscience 2023Quote: ... 72°C – 1 min]) with NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) and barcoded Nextera primers (1.25 μM each ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products were generated using the OneTaq Quick-Load 2x PCR Master Mix with Standard Buffer (NEB) in accordance with manufacturer instructions with C ...
-
bioRxiv - Genetics 2023Quote: We performed n=30 PCR1 reactions per sample using Q5 High Fidelity 2X Master Mix (NEB #M0429S) with 10 ug of genomic DNA to maintain ≥1000X representation ...
-
bioRxiv - Microbiology 2023Quote: ... Linearized pExTra01 plasmid was prepared for isothermal assembly reactions via PCR (NEB Q5 HotStart 2X Master Mix) of pExTra01 using divergent primers pExTra_F and pExTra_R ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.5𝜇L of each primer (Where each reaction had non-barcoded primer "Ad1_noMix" and one barcoded primer ’Ad2.1’ - ’Ad2.9’ added) and 25𝜇L NEBNext High-Fidelity 2x PCR Master Mix (NEB) and was run under the following conditions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR reactions were performed with Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) in 20 µl reactions and products were run on a 1% agarose gel alongside an appropriately sized ladder (either New England Biolabs 100 bp or 1kb DNA ladder ...