Labshake search
Citations for New England Biolabs :
7151 - 7200 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: Mutants in the CG-1 domain were created using the Q5 site-directed mutagenesis kit (New England Biolabs, USA) as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification was done in a 25µl reaction with 1 unit of NEB Taq DNA polymerase (NEB Catalog# M0273S), 1x Standard Taq Buffer ...
-
bioRxiv - Molecular Biology 2023Quote: For DNA-RNA hybrid IP (DRIP) non-crosslinked lysates were incubated (1 h, 37°C) with 10U RNaseH (NEB) prior to immunoselection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.0-3.0 μg of DNA was used for a ligation reaction in a volume of 1 mL using 1.0 μL of 2000 U/μL T4 DNA Ligase (NEB) for 3C experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of immunopurified GST-tagged WRN fragment was phosphorylated in vitro by Casein Kinase II (New England Biolabs) in the presence of 1X NEBuffer (50mM Tris-HCl ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... mRNA was isolated from ~1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490). RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies 5067-1513) ...
-
bioRxiv - Immunology 2022Quote: ... Then 1 μg of vaccine mRNA was ligated to 20 pmols RA3_7N adaptor: 5rApp/CTGACNNNNNNNTGGAATTCTCGGGTGCCAAGG/3ddC with 10U of T4 KQ227 RNA ligase 1 (#M0204S NEB) in the presence of 20U RNase OUT (#10777019 ...
-
bioRxiv - Cell Biology 2022Quote: ... Tracheal chitin was stained with 505 star conjugated chitin-binding probe (NEB, Frankfurt/M, Germany, used at 1:300). Nuclei were stained with 4’,6-Diamidino-2-Phenylindole ...
-
bioRxiv - Biochemistry 2022Quote: ... and 10 μM GDP and incubated for 1 h at room temperature prior to adding 0.25 units of Apyrase (NEB) and incubation for a further 1 h at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... reactions were carried out in a total of 25 μL containing 1 X Isothermal Amplification Buffer (New England Biolabs), 5 mM MgSO4 ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 µL of T4 DNA Ligase and 1 µL of 10 mM ATP (all reagents from New England Biolabs, Ipswich ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of the reaction product was treated with 1 μL of CIP or nuclease P1 (New England BioLabs) at 37 °C for 1 h and inactivated at 80 °C for 10 min prior to centrifugation and analysis by HPLC.
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... Column-bound DNA was eluted in TE buffer (10 mM Tris-Cl, pH 8.0; 1 mM EDTA, pH 8.0) and treated with AsiSI (NEB, R0630S) and PacI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... in a total reaction volume of 100 µL consisting of 50 units of T4 RNA ligase 1 (NEB #M0204S), 1mM ATP ...
-
bioRxiv - Cancer Biology 2023Quote: ... a Poly(A) tailing reaction was performed for 1 hour according to the HiScribe T7 ARCA manual (NEB, E2060S). Subsequently ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM dithiothreitol (catalog no ...
-
bioRxiv - Genomics 2023Quote: ... Following this, 2μL Exonuclease 1 (20U/μL, Enzymatics X8010L) and 1μL Shrimp Alkaline Phosphatase (rSAP) (1U/μL, NEB M0371L) was added to each reaction followed by vortexing and incubation in a thermocycler at 37°C for 30min followed by 4°C forever.
-
bioRxiv - Molecular Biology 2023Quote: ... in buffer 3 (100 mM NaCl, 50 mM Tris-HCl, pH 7.9, 10 mM MgCl2, and 1 mM DTT, New England Biolabs) or in 50 mM NaCl ...
-
bioRxiv - Genetics 2023Quote: ... 8.5 μl of phosphorylated product was combined with 1 μl of 10x T4 ligase buffer and 0.5 μl of T4 DNA ligase (NEB), incubated at 16℃ overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Microbiology 2023Quote: A 10 µL reaction containing 200 ng of pTrc200HA plasmid DNA and 1× CutSmart Buffer (New England BioLabs, USA) with partially purified V2c or its variants normalized by the major V2c protein band was incubated at 37°C for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM DTT (catalog no ...
-
bioRxiv - Molecular Biology 2023Quote: ... that can base pair to the 3’ nucleotide of the cDNA products as described.75,76 The reaction was stopped by adding proteinase K (1 unit; New England Biolabs) and 25 mM EDTA followed by clean-up with a Monarch PCR & DNA Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Biochemistry 2024Quote: ... and clarified by centrifugation at 16,100 x g for 1hr and incubated with ∼1 mL of pre-equilibrated compact amylose affinity resin beads (NEB). The resin was washed three times with buffer H ...
-
bioRxiv - Microbiology 2024Quote: ... a 30 uL aliquot of lysate was transferred to a clean 1.5 mL microcentrifuge tube and incubated with 1 uL Endo-H (NEB) for 45 min in a 37C bead bath ...
-
bioRxiv - Microbiology 2024Quote: ... Flanking regions of 1 kb on either side of the target gene were PCR amplified using Q5 polymerase (NEB) and cloned into pLGB13 using the NEBuilder HiFi cloning kit (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 1:200 dilution of the double-stranded gRNA was ligated into BsmBI-digested plasmids using T4 ligase (NEB). One µL of the ligated vector was then transformed into chemically competent XL Gold E ...
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.81 nmol LbCas12U protein and 0.45 nmol of each of three crRNAs were assembled in 1 x Nuclease Reaction Buffer (NEB). Protein and crRNAs were mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were split into two equal samples and incubated at 50°C for 25 minutes with exonuclease 1 (NEB, M0293) to remove unintegrated barcoded transposon adapters ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg mL−1 BSA at pH 7.9; New England Biolabs). The reactions were incubated at 37 °C for 20-45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All reactions were then digested with 1 µl ExoI and purified using the Monarch DNA Gel Extraction Kit (NEB), eluting in 10 µl of elution buffer (10 mM Tris•Cl pH 7.4) ...
-
bioRxiv - Microbiology 2024Quote: ... the pCDFDuet-1 vector was linearized via PCR using Q5® High-Fidelity DNA Polymerase (New England Biolabs, NEB) with primers listed in Supplementary Table 10 ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae were euthanized with ice and digested in 100 µL TE buffer with 1 µL ProK (New England Biolabs). They were then genotyped by PCR and Sanger sequencing ...
-
bioRxiv - Evolutionary Biology 2024Quote: Conventional PCR was conducted using plasmids of Sfla Or42a3 as backbone (Q5 DNA polymerase, #M0491, NEB; Supplemental File 1). Primers were designed to introduce the point mutations (Supplementary File 1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA from each phosphatase or control reaction was then used to set up two reactions 20 μL reactions containing 1 μg of treated RNA in NEBuffer 3.1 (New England Biolabs) with or without the addition of 1 μL (1U ...
-
bioRxiv - Microbiology 2024Quote: ... the pCDFDuet-1 vector was linearized via PCR using Q5® High-Fidelity DNA Polymerase (New England Biolabs, NEB) with primers listed in Supplementary Table 10 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was performed in 20 µl at 42°C for 1 h using AMV reverse transcriptase (NEB, M0277), and 5 µl of the RT reaction was amplified in 25 µl using AccuPrime Pfx DNA polymerase (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was performed in 20 µl at 42°C for 1 h using AMV reverse transcriptase (NEB, M0277), and 5 µl of the RT reaction was amplified in 25 µl using AccuPrime Pfx DNA polymerase (ThermoFisher ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were washed three times prior to labeling by incubation in 1 µM BG-Alexa-546 (New England BioLabs) in EX for 20 min at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... samples were digested by incubation in reverse-crosslinking buffer (50 mM Tris pH 8.0, 50 mM NaCl and 0.2% SDS) with 1:50 proteinase K (NEB P8107S) for 30 min at 55 °C in the dark ...
-
bioRxiv - Genomics 2024Quote: ... the RT product was digested overnight at 37°C with 1 unit of USER Enzyme (New England Biolabs, M5505L) per µg of product ...
-
bioRxiv - Bioengineering 2024Quote: ... GTP was added to a final concentration of 2 mM along with a buffer including magnesium (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH = 7.5; New England Biolabs) into circRNA solution ...
-
bioRxiv - Biophysics 2024Quote: ... 800 μL of 2 M MgCl2 and 1.6 mL 1 M CaCl2 were added to the lysed cells along with 2.5 μL DNase (New England Biolabs) and OmniCleave endonuclease (Biosearch Technology ...
-
bioRxiv - Immunology 2024Quote: ... Reverse transcription was then performed with 0,5-1 μg of RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) and 3′-RACE CDS primer (Clontech) ...
-
bioRxiv - Genomics 2024Quote: ... We performed PCR reactions using 1 ng of the pooled gRNA library plasmids per reaction with Q5 polymerase (NEB). The correct size band from the PCR product was then gel-purified from a 2% E-gel EX (Life Technologies ...
-
bioRxiv - Genomics 2024Quote: ... the PCR product was digested overnight at 37°C with 1 unit of NheI-HF (New England Biolabs, R3131) per µg of product ...
-
bioRxiv - Cell Biology 2024Quote: ... SNAP-tagged GLP-1R was detected with an anti-SNAP tag rabbit polyclonal antibody (1:500; New England Biolabs) followed by goat anti rabbit IgG HRP (1:2,000 ...