Labshake search
Citations for New England Biolabs :
6901 - 6950 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: Vector backbones were obtained by restriction digest and component parts for vector inserts were generated by PCR from synthesised DNA or existing vector templates using Q5® High-Fidelity 2X Master Mix (NEB). Vector components were purified using the Monarch® DNA Gel Extraction Kit or the Monarch® PCR & DNA Cleanup Kit (NEB ...
-
bioRxiv - Genetics 2021Quote: ... 1ul of cDNA was used to perform a first round of PCR (20ul volume) with Taq DNA polymerase (New England BioLabs, M0273) for 20-25 cycles and primers listed in Table 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The tln1A% allele was genotyped by amplifying the locus through PCR and digestion of the amplicon with the restriction enzyme Sau3AI (New England Biolabs, R0169L). The digest yields a 122 bp and a 53 bp fragment for the tln1 wild-type allele and in a 171 bp fragment for the tln1d4 allele ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Adapters for Illumina sequencing were subsequently extended via a 10-cycle PCR with Phusion high-fidelity DNA polymerase (New England Biolabs, Inc.). Final reactions were purified via AMPure XP beads and standardized per submission requirements of the DNA Core Facility (University of Oregon Genomics & Cell Characterization Facility ...
-
bioRxiv - Developmental Biology 2020Quote: Each Mmp13 promoter sequence was amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (M0493L, NEB, Ipswich, MA, USA). To generate luciferase constructs ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 100 ng of gDNA was used as template for PCR using Q5 Hot Start DNA Polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were run on 2% agarose gels and the Quick load 100pb DNA ladder (New England Biolabs Inc., Ipswich, MA) was used for fragment size visualization ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified PCR products were ligated into the recombinant plasmid pZE0-P-MglE-T using the recommended standard USER cloning protocol (NEB, UK).
-
bioRxiv - Molecular Biology 2020Quote: ... The amplicon was purified with a Qiagen PCR purification kit and digested with the restriction enzymes KpnI and HindIII (NEB, UK), followed by ligation using T4 DNA ligase (Fermentas ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA substrates for in vitro cleavage represent fragments of human mitochondrial DNA amplified by PCR in Q5® High-Fidelity 2X Master Mix (M0492L, NEB). As a template ...
-
bioRxiv - Molecular Biology 2020Quote: ... using BamHI and NdeI sites added on mCherry during PCR amplification with the Q5® High-Fidelity DNA Polymerase (NEB, #M0491). The pBabe-H2B-GFP plasmid (Addgene #26790 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mcr-1 gene along with its natural promoter was PCR-amplified from the natural PN16 (IncI2) plasmid using Q5® High-Fidelity DNA Polymerase (New England BioLabs). The amplified and purified mcr-1 fragment was assembled together with PCR-amplified pSEVA121 backbone using NEBuilder® HiFi DNA Assembly Master Mix according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with the oligonucleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit 5 µg user manual (NEB #T1030). Clean PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Genomics 2020Quote: ... The tagmented cDNA was then amplified with barcodes using the Phusion High Fidelity PCR master mix (New England Biolabs cat# M0531L). The amplification program was set to 1 ...
-
BET protein inhibition regulates macrophage chromatin accessibility and microbiota-dependent colitisbioRxiv - Immunology 2021Quote: ... Transposed DNA samples were purified using the Qiagen MinElute Kit (#28204) followed by amplification using 1x PCR master mix (NEB #M0541S) and 25 μM Ad1_noMX and Ad2.* indexing primer for 10-14 cycles ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Genomics 2020Quote: ... The IntS6 PCR product and pMK33-SBP C-terminal vector (Yang and Veraksa, 2017) were digested with XhoI and KpnI-HF (NEB R3142) at 37°C overnight and purified digests were ligated overnight at 16°C ...
-
bioRxiv - Physiology 2019Quote: ... The obtained 20-nt sequences were incorporated into a DNA oligonucleotide template containing a T7 promoter and a sgRNA scaffold by overlapping PCR using Phusion high fidelity DNA polymerase (New England Biolabs, M0530). The primer sequences for overlapping PCR were as previously described11 including the designed sgRNA sequences ...
-
bioRxiv - Microbiology 2019Quote: ... Typhimurium NCTC 12023 and the vector including the Tet-on system aph tetR PtetA present on p4392 occurred using oligonucleotides as listed in Table S 1 and purified by PCR purification (NEB Monarch). The PCR product encoding for sadBA and the PCR product from vector p4392 were assembled by Gibson assembly according to manufactureŕs protocol (NEB Monarch) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-ACGTACGCGGCCGCAAAATGAGGCTGCACCTGGCGGCGATCC-3’ and 5’-ACGTACTCTAGACTACTCGTGCCACTCGATCTTCTGGGCTTCAAATATGTCATTCA AACCGCCTCCAATTACAAAGGCCGTGATCCAGTCCAGAAACTTGGCC were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing a Drosophila gd cDNA as template ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Biochemistry 2019Quote: ... TR standards for northern blots were in vitro transcribed from PCR products using the HiScribe™ T7 high yield RNA synthesis kit (New England Biolabs). Band intensities were quantified using ImageQuant TL 8.2 (GE Healthcare Life Sciences).
-
bioRxiv - Synthetic Biology 2019Quote: ... 1 μl of the supernatant was used as the PCR template in a 20 μl-reaction with Q5 High-Fidelity DNA Polymerase (New England Biolabs, US). Lastly ...
-
bioRxiv - Genomics 2019Quote: ... The DNA (50-100 ng) was amplified using the Phusion Hi-Fi PCR master mix with HF buffer (New England Biolabs M0531) or the Q5 Hot Start HiFi PCR master mix (New England Biolabs E6625AA ...
-
bioRxiv - Immunology 2019Quote: ... The ITS2 region was amplified and Illumina adapters appended by PCR in 25 ul volume with Q5 High-Fidelity 2X master mix (NEB, # M0492L). PCR conditions were as follows ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Genomics 2019Quote: ... Sequencing adapters and oligonucleotides used for PCR barcoding were from the NEBNext Multiplex Oligos for Illumina Kit (New England Biolabs, NEB). Prior to PCR amplification of the library ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and a PCR product of about 300 nucleotides from a coding sequence was than amplified by PCR using Q5® High-Fidelity DNA polymerase (New England Biolabs). The resulting PCR products were gel purified ...
-
bioRxiv - Biochemistry 2019Quote: ... site-directed mutagenesis was conducted using overlap extension PCR (Pavoor et al. 2009) using the Phusion DNA polymerase (New England Biolabs # M0530) (see Supp ...
-
bioRxiv - Genetics 2019Quote: ... 2 μl of genomic DNA was used as template in a 40 μL PCR reaction with LongAmp® Taq DNA Polymerase (NEB). The 415bp PCR fragment of white target was amplified with CGTTAGGGAGCCGATAAAGAGGTCATCC (w.sF ...
-
bioRxiv - Microbiology 2019Quote: ... Donor sequences which typically contain 500-bp upstream and 500-bp downstream of the editing sites were amplified by PCR and ligated into the linearized targeting plasmid (digested by XhoI (NEB, USA)) using the ClonExpress One Step Cloning Kit (Vazyme ...
-
bioRxiv - Cancer Biology 2019Quote: sgRNA barcode sequences were amplified by PCR using the extracted gDNA from either CRISPRi or CRISPRa screens as template and Phusion (NEB M0530) as polymerase ...
-
bioRxiv - Developmental Biology 2019Quote: ... Each potential sgRNA off target site listed in Table S2 (off-target score provided by Benchling) was screened by High-Fidelity PCR (Q5 NEB, M0491L) with primers listed in Table S5 and PCR products were sequenced using Eurofins Genomics tube DNA sequencing services ...
-
bioRxiv - Genetics 2019Quote: ... PCR amplification of short DNA fragments (<3000 bp in length) was conducted using OneTaq® DNA polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genetics 2019Quote: ... PCR amplification of short DNA fragments (<3000 bp in length) was conducted using OneTaq® DNA polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Systems Biology 2019Quote: ... REV: TTACTTCGCTGTCATCATTTGTACAAACTCTTCGTAG) pEntry_GCaMP5G was linearized with PCR reaction using standard Phusion® Hot Start Flex 2X Master Mix (NEB Cat# M0536L) protocol (FOR ...
-
bioRxiv - Genetics 2019Quote: ... Homology arms for the SPO11 BAC were introduced by PCR with Phusion polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany). The 1.3 kbp PCR product was purified with a Gel Extraction Kit (QIAGEN ...
-
bioRxiv - Genomics 2021Quote: ... standard Gibson Cloning for S1 or S2 inserts plus PCR-amplified/DpnI-digested backbone was performed using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) at 3:1 insert to vector ratio ...
-
bioRxiv - Genetics 2019Quote: ... Purified DNA was used to construct high-throughput sequencing libraries using NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs M0541). DNA libraries were processed on a Illumina NextSeq machine for paired-end 41-nt sequencing ...
-
bioRxiv - Genomics 2021Quote: ... 5.25 mg of genomic DNA (gDNA) was used as template across 525 x 100 µL PCR reactions using Q5 2X Master Mix (NEB, M0492L). For the distal sub-library screens ...
-
bioRxiv - Genomics 2020Quote: ... were dispensed at 35nL in wells that contained single cells followed by two dispenses of 50nL (100nL total) 2x NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L). The chip was sealed and spun down at 2250xg for 3 mins after each dispense ...
-
bioRxiv - Microbiology 2021Quote: ... The resultant PCR fragments were inserted into the BamHI site in pAK405 by NEBuilder HiFi DNA assembly cloning kit (New England Biolabs, Inc.). These plasmids were independently introduced into SYK-6 and its mutant cells by triparental mating ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL P7 primer (10 μM) (5ʹ-CAAGCAGAAGACGGCATACGAG AT[i7] GTCTCGTGGGCTCGG-3ʹ; IDT) and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541). Amplification was performed using the following program ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 200 ng of sheared gDNA and 10 PCR cycles using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S). The DNA libraries were indexed with unique dual barcodes (8bp long) ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was carried out using NEB Luna Universal Probe One-Step Reaction Mix and Enzyme Mix (New England Biolabs, Herts, UK), primers and probe at 500 nM and 127.5 nM ...
-
bioRxiv - Biochemistry 2021Quote: ... Successful generation of ΔpufX and ΔpufY strains was confirmed using PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, UK) and DNA sequencing (Eurofins).