Labshake search
Citations for New England Biolabs :
7101 - 7150 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and PCR amplification to prepare cDNA libraries using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, USA). Library preparation and next-generation sequencing were outsourced to Rhelixa Inc ...
-
bioRxiv - Genomics 2023Quote: ... Both libraries were ordered as synthesized oligo pools (Integrated DNA Technologies) and PCR-amplified with Q5 DNA polymerase (New England Biolabs M0492) using an optimized two-round amplification strategy to minimize barcode-sgRNA recombination ...
-
bioRxiv - Genomics 2024Quote: ... Amplicons were then barcoded for NGS by combining 2 µL of amplicon from the previous PCR with 1X Q5 High-Fidelity Master Mix (New England Biolabs M0492) and 500 nM forward and reverse indexing primers (Integrated DNA Technologies) ...
-
bioRxiv - Genomics 2024Quote: The gRNA libraries were amplified from each gDNA sample across 100 μL PCR reactions using Q5 hot start polymerase (NEB, M0493) with 1 μg of gDNA per reaction ...
-
bioRxiv - Genetics 2023Quote: ... oligonucleotide pools were amplified by 8 to 10 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544X), digested with BstXI and BlpI ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were then centrifuged at 13000 x g for 1 minute and the supernatant was once more purified using the Monarch® PCR & DNA Cleanup Kit (New England BioLabs). We expect the “crush and soak” method to improve signal strength if low labeling densities are used during extension.
-
bioRxiv - Neuroscience 2023Quote: PCR amplicons were tested for the presence of mutations using a T7 endonuclease I assay (New England Biolabs®, Ipswich, USA). 10 μL of each PCR was subjected to electrophoresis on a 1% agarose gel according to the protocol below ...
-
bioRxiv - Microbiology 2023Quote: ... hcp and tssB flanking regions were PCR-amplified from CFBP13503 with the Phusion High-Fidelity DNA polymerase (New England Biolabs, France), and the primer pairs listed in Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... The ADT-derived cDNAs contained in the supernatant were further purified (see SI Appendix) and used as template in a PCR reaction with the NEBNext® High Fidelity Master Mix (NEB), a Truseq small RNA RPIx (containing i7 index ...
-
bioRxiv - Genetics 2023Quote: ... was then linearized by Esp3i digestion and the HDAC4 PCR fragment was annealed downstream into the open reading frame with gibson assembly using NEB HiFi mastermix (NEB 2621L). After delivering the construct by lentivirus ...
-
bioRxiv - Microbiology 2023Quote: ... 1990) tagged with Illumina adapters in PCR reactions using a Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs). The 25 amplification cycles were as follows ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR amplification of DNA fragments was performed using high-fidelity polymerases: Q5 DNA Polymerase (New England Biolabs, Frankfurt am Main, Germany), Phusion Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... ER and AD variants were obtained with PCR-amplified gene fragments (IDT gBlocks™) using restrictionbased cloning with enzymes purchased from NEB. Information on tested plasmids ...
-
bioRxiv - Pathology 2023Quote: ... cDNA then was used as a template for barcoding PCR following ONT’s protocol (SQK-LSK110 with EXP-PBC096) and LongAmp Taq 2× Master Mix (NEB, Ipswich, MA). The barcoded amplicons were bead purified at a 0.8× beads:solution ratio before being pooled by equal volume with libraries from unrelated samples and a library generated from HeLa RNA (ThermoFisher)
-
bioRxiv - Molecular Biology 2022Quote: ... pHAGE lentiviral plasmids encoding the six other HCoV N-EGFP were generated by replacing SARS-CoV-2 N with the respective HCoV N sequences by PCR (New England Biolabs M0492S) and NEBuilder HiFi DNA Assembly (New England Biolabs E2621S) ...
-
bioRxiv - Microbiology 2023Quote: Plasmid construction was performed by: PCR amplification of the fragment to insert in the plasmid with Q5® High-Fidelity DNA Polymerase (New England Biolabs), digestion with the appropriate FastDigest restriction enzymes (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... Substrates were transcribed in vitro from purified PCR products using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Each sample was amplified in triplicate 25 μl reactions consisting of primers at final concentrations of 0.2 μM and 1X PCR reagent (Q5® Hot Start High-Fidelity 2X Master Mix, New England BioLabs, UK). Triplicate PCR reactions for each sample were then pooled and purified using Agencourt® AMPure® XP beads (#A63881 ...
-
bioRxiv - Microbiology 2023Quote: ... The AvcI DNA template for in vitro transcription was PCR amplified from pAvcI using Q5 High-Fidelity DNA Polymerase (NEB™). To incorporate the T7 promoter into the final AvcI DNA template ...
-
bioRxiv - Cell Biology 2023Quote: ... The 3xNLS-mScarlet-I insert was synthesised as a gblock (Genewiz) and PCR amplified (New England Biolabs, M0515, Q5 Hot start) with primers FW 5’- CCACCGGCCGGTCGCATGCCAAAAAAGAAGAGAAAGGTAGACC -3’ and RV 5’- TCGAGTGCGGCCGCTTTATTTCTTTTTCTTAGCTTGACCAGCTTTCTT -3’ to create overhanging microhomologies ...
-
bioRxiv - Synthetic Biology 2023Quote: All the plasmids were generated Gibson assembly59 by relying on gene synthesis and PCR using Q5 master mix DNA Polymerase (New England Biolabs, USA) with 40-bp homology domains ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified PCR products and the destination vector pSIN-TRE3G-GFP-miRE-PGK-Neo were digested with XhoI/EcoRI 37°C for 1 h and the PCR product was ligated into the destination vector using T4 DNA ligase (NEB, # M0202L) overnight at 16 °C.
-
bioRxiv - Genomics 2023Quote: Library oligos for the MYC enhancer screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), forward primer ...
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The digested fragments were gel-purified and then cleaned up using a GenepHlow™ Gel/PCR Kit before ligation into the appropriate vector using T4 ligase (New England Biolabs). The ligated plasmids were transformed into DH5α ...
-
bioRxiv - Bioengineering 2023Quote: ... The MAAP-WT2 DNA sequence was isolated from the AAV2 genome by Q5 Polymerase-based PCR (New England Biolabs, Ipswich, MA) and cloned into pSubMAAP to assess MAAP effects of MAAP knockout and reconstitution (Figures 1A-F and 2A-F) ...
-
bioRxiv - Microbiology 2023Quote: ... The unique barcoded region was amplified from 500ng genomic DNA with 16 cycles of PCR using NEBNext Ultra II Q5 master mix (NEB M0544L) as described in30 ...
-
bioRxiv - Cell Biology 2023Quote: ... and the integrated sgRNA library was amplified from the genomic DNA by PCR using Q5 Hot Start High-Fidelity 2x Master Mix (NEB #M0494L) and oligos ol3 and ol4 (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2023Quote: ... For in vitro transcription plasmids were first linearised by restriction digest and purified using Monarch PCR and DNA Clean-up Kit (NEB, USA). 3’UTRs were in vitro transcribed from 500ng of plasmid DNA using MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was purified by phenol-chloroform extraction and used for in vitro transcription using SP6 RNA-polymerase (NEB, M0207). The resulting sgRNA was purified using the High Pure PCR Cleanup Microkit (Roche ...
-
bioRxiv - Genomics 2023Quote: ... with the exception that elution of the Tn5 treated DNA was performed using the Monarch PCR and DNA clean-up kit (NEB T1030S) following a 5:1 ratio of Binding Buffer:Sample ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Oligonucleotides were synthesised by Macrogen (Seoul, South Korea) and PCR amplification performed using Phusion polymerase (New England Biolabs; Ipswich, MA, USA) unless otherwise stated ...
-
bioRxiv - Genetics 2023Quote: ... the PCR products containing the geneticin1-664-PgpdA-RB and the SpecR-Ori were digested with SapI (New England Biolabs, UK) and ligated with T4 DNA ligase ...
-
bioRxiv - Genomics 2023Quote: ... Beads were washed with 200 μl buffer EB and resuspended in 400 μl of Post-TdT PCR mix (1x NEBNEXT Ultra II Q5 Master Mix (NEB, M0544L), 0.5 μM post-TdT-poly(C)12-S Primer ...
-
bioRxiv - Microbiology 2023Quote: ... Resolved strains (GFP-negative and kanamycin-sensitive) were tested for the desired genotype by colony PCR (OneTaq® 2X Master Mix with Standard Buffer, New England Biolabs). All the plasmids are listed in Table 2.
-
bioRxiv - Synthetic Biology 2023Quote: ... mAmetrine was inserted in place of GFP in both pDawn and pDusk plasmids via PCR and Gibson assembly (NEB HiFi mix). Using the same method ...
-
bioRxiv - Biophysics 2023Quote: We digested the phosphorylated strand by incubating each μg of the above obtained PCR product with 2.5U λ-exonuclease (NEB, M0262L) in 100 μl 1X reaction buffer at 37 °C for 1 hour followed by a 30 min heat-inactivation step at 75 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... A PCR-amplified DNA fragment of pcDNA3-DNMT1 was generated using Q5 Site-Directed Mutagenesis Kit (E0554S, NEB, Ipswich, MA, USA). The primers used in this process are described in Supporting Information ...
-
bioRxiv - Biophysics 2023Quote: ... colonies carrying correct clones were identified by colony PCR using OneTaq® Hot Start Quick-Load® 2X Master Mix (NEB), and plasmids were purified from overnight culture in LB containing 150 μg/ml ampicillin at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA barcodes were amplified by PCR using the gDNA from at least 6 mio cells as template and Phusion (NEB M0530) as polymerase ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR sgRNA resistant synonymous or functional domain point mutations were introduced by PCR mutagenesis using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2631). Stable cell lines were generated using the pLU vectors and selected with puromycin or blasticidin ...
-
bioRxiv - Genomics 2022Quote: ... The enhancer was amplified by PCR to add overhangs to the backbone vector (GWLP P29-30) and assembled into the backbone by HiFi Assembly (NEB #E2621).
-
bioRxiv - Genomics 2022Quote: ... signal constructs were amplified by PCR from different plasmids and assembled using the NEBuilder HiFi DNA Assembly Master Mix (HiFi Assembly, NEB #E2621). The BxbI attP site was then added using the Q5 Site-Directed Mutagenesis Kit (Q5 SDM ...
-
bioRxiv - Genetics 2023Quote: ... Knockout of the genes was confirmed by running PCR reactions using Q5® High-Fidelity DNA Polymerase (NEB, cat no. M0491) and the following primers on a 2.5% agarose gel:
-
bioRxiv - Genetics 2023Quote: ... The GAL1p promoter was amplified by PCR from genomic DNA and assembled into NcoI and SpeI digested pML107 using the HiFi DNA Assembly mix (NEB # E5520). The gRNA scaffold sequence was further modified to replace the SwaI and BclI fragment with a BaeI fragment from pML107 by HiFi Assembly.
-
bioRxiv - Developmental Biology 2023Quote: ... was combined with either MEP-1 or Mi-2 PCR-amplified coding sequences in a Gibson assembly reaction using NEBuilder® HiFi DNA Assembly kit (NEB) following manufacturers protocols ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR reaction volume used was 50 μl: 0.2 μl of Q5® high-fidelity DNA polymerase (New England Biolabs, UK), 10 μl of Q5® reaction buffer (5X ...
-
bioRxiv - Genomics 2023Quote: ... Multiplex-polymerase chain reaction (PCR) was performed in two separate reaction mixes prepared by combining 5 μl of 5X Q5 Reaction Buffer (NEB, M0493S), 0.5 μl of 10 mM dNTPs (NEB ...
-
bioRxiv - Genetics 2023Quote: ... cDNA and sequencing libraries were generated from 500 ng of fresh RNA samples with 10 cycles of PCR with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #7760). After quality checking using an Agilent 2100 Bioanalyzer ...