Labshake search
Citations for New England Biolabs :
6751 - 6800 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA cassettes were isolated by two rounds of PCR using a previously published strategy (17) with NEBNext Ultra II Q5 Master Mix (New England Biolabs) and primer pairs listed in Extended Data Table 2.
-
bioRxiv - Synthetic Biology 2023Quote: ... The origin of replication and antibiotic resistance gene fragments were obtained from source plasmids by PCR amplification with Q5 HiFi DNA polymerase (NEB). The multiple cloning site ...
-
bioRxiv - Microbiology 2023Quote: ... open reading frame was amplified from genomic DNA of the 237 Moraxella bovoculi strain by PCR and cloned into the pTN7C130 vector using HiFi assembly (NEB). The pTN7C130 vector is a mini-Tn7 vector that integrates into the attTn7 site of P ...
-
bioRxiv - Bioengineering 2023Quote: Double-stranded linear DNA template for HDR and electroporation was amplified from plasmid DNA by PCR using Q5 High-Fidelity Master Mix (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... We combined the plasmid backbone with the colony PCR insert by mixing them in molar ration 1:3 in the 2xHiFi mix (New England Biolabs). We incubated the reaction at 50°C for 60 min ...
-
bioRxiv - Bioengineering 2023Quote: ... are decided by the Ct value from a qPCR reaction (NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs)) for the specified cDNA concentration ...
-
bioRxiv - Genetics 2023Quote: ... A second primer was then added and a complementary mutated bottom strand synthesised using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) and Taq DNA ligase ...
-
bioRxiv - Genomics 2023Quote: ... ninety-six 20 μl ePCR reactions were performed using 0.01 fmol of pooled oligos with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). Each 20 μl PCR mix was combined with 40 μl of oil-surfactant mixture (containing 4.5 % Span 80 (v/v) ...
-
bioRxiv - Molecular Biology 2023Quote: ... were amplified out of cDNA from Arabidopsis Col-0 or an SICp:SICm-Venus-HA transgenic line (see below) by PCR with Q5 High Fidelity Polymerase (New England Biolabs, www.neb.com). Primers “WARP2cdsGATEF” and “WARP2cdsR” were for SIC and primers “DBR1_CDS_nostp_CACC_F” and “DBR1_CDS_stp_R” were for DBR1 (Table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: The extracted DNA was used as a template to amplify the variable region by a two-step PCR strategy using a high-fidelity DNA polymerase (NEBNext ultra II Q5 master mix, M0544L, NEB). The first PCR of 22-24 cycles was performed using primers #232 to #273 (Table S9 ...
-
bioRxiv - Genetics 2023Quote: ... The primers contained 60 bases pairs of homologies for the downstream and upstream region of the arcZ gene as well as homology with the kanamycin resistance gene (ArcZkanfor and ArcZkan) PCR was carried out with the Q5 2X Master Mix (New England Biolabs). The mixture was run in the thermocycler with a denaturation temperature of 95°C ...
-
bioRxiv - Immunology 2023Quote: ... were purified using the QIAquick PCR purification kit and ligated into the appropriate linearized expression vectors using T4 DNA ligase (New England BioLabs) and incubated overnight at 16°C.
-
bioRxiv - Neuroscience 2023Quote: ... Genotypes for SNVs were determined by restriction digestion of its PCR products with suitable enzymes (New England Biolabs Inc, Ipswich) following manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 kb of genomic DNA upstream of the TgAPT1 stop site was amplified by PCR using Q5 high fidelity polymerase (New England BioLabs) using the Ku80 genomic DNA as a template and the primers TgAPT1 F1 and TgAPT1 R1 (Table 2) ...
-
bioRxiv - Microbiology 2023Quote: ... The mWasabi sequence under the control of the constitutive Pleft* promoter45 was amplified by PCR using a Q5 high-fidelity DNA polymerase (New England Biolabs). Plasmids were linearized with KpnI-HF (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... Ddc2-CC (residues 1-148) fragment was PCR amplified from yeast cDNA library with Phusion polymerase and digested with BamHI-XhoI (NEB) restriction endonuclease ...
-
bioRxiv - Biochemistry 2023Quote: Human HA-DHFR was subcloned from human cDNA to pcDNA4/TO by PCR using Q5 High Fidelity 2X mastermix (NEB). Human FPGS-FLAG and GGH-FLAG were subcloned from cDNA clones MHS6278-202755815 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2023Quote: ... to pcDNA4/TO and PiggyBac-CMV-MCS-IRES-mCherry and PiggyBac-CMV-MCS-IRES-mNeongreen by PCR using Q5 High Fidelity 2X mastermix (NEB). PiggyBac-CMV-MCS-IRES-NLS-TagBFP was used as empty vector control ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene fragments encoding TwCel5CAT and TwCel5CBM were generated using through PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and the primers described in Table S1 ...
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cell Biology 2023Quote: ... generated by randomly primed DNA synthesis using an 800 bp PCR product overlapping with the 1394 bp restriction fragment as a template and Klenow polymerase (NEB). Telomeric restriction fragment analysis was carried out as previously described (Nandakumar et al. ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Cancer Biology 2022Quote: ... containing the sgRNA sequences were resuspended at 100 nM in H2O and amplified by PCR using HF Phusion polymerase (New England Biolabs). After verifying amplification on a 10% acrylamide gel ...
-
bioRxiv - Biophysics 2023Quote: Illumina sequencing adapters were added by ligation mediated PCR using the NEBNext UltraII DNA Library Prep Kit (New England BioLabs). The libraries were Bioanalyzed on a high sensitivity DNA chip ...
-
bioRxiv - Cancer Biology 2023Quote: ... The point mutations G729E and G719F were introduced into the EGFR-WT expression vector by PCR using Phusion high fidelity DNA polymerase (New England Biolabs). PCR product obtained was digested by methylation-specific enzyme DpnI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The six PCR products were then inserted into the ClaI-digested plasmid in a single reaction with NEBuilder (NEB, #M5520AA). All cloning products were verified by control restriction digestion and Sanger sequencing ...
-
bioRxiv - Genomics 2022Quote: ... was PCR amplified (495bp) and cloned into the Lucia vector (Supplementary Figure 4) using ApaI and BamHI restriction enzymes (NEB, Catalog no ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products were gel-purified and then assembled into a plasmid backbone digested with MluI (New England BioLabs, R3198S) and SpeI (New England BioLabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... Large dsDNA donor molecules with ∼40 bp homology arms on each end were prepared by PCR using Q5 DNA Polymerase (New England BioLabs) and purified using HighPrep PCR Clean-up beads (MagBio ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The isolated DNA and the initial infectious plasmid were used as DNA template for polymerase chain reaction (PCR) using 30 cycles and the Q5 High Fidelity DNA Polymerase (New England BioLabs) under the recommended conditions by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Systems Biology 2023Quote: ... The DpnI-treated linear plasmid backbones were then mixed with the relevant PCR amplified tile and assembled by in vitro recombination with the NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs). The assembly reactions were purified ...
-
bioRxiv - Biochemistry 2023Quote: ... the first round of PCR consisted of 7 cycles of the following program using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Step1 ...
-
bioRxiv - Biochemistry 2023Quote: ... A 200nt polyA tail was added through PCR and in vitro transcription was carried out using the HiScribe T7 High Yield RNA Synthesis kit (NEB). An m7G cap was introduced by using Vaccinia capping enzyme (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: Site-directed mutagenesis of StCphA2 was by performing PCR reactions with 10 ng template in Phusion® HF buffer (NEB), 0.2 mM of each dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... Around 1μg of DNA was isolated from each reaction using a Monarch PCR & DNA Cleanup Kit (elution volume of 15 μl, NEB). The DNA was treated with 5 U of Antarctic Phosphatase (NEB #M0289S ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 ng of DNA was inputted into a first round of PCR (27 cycles, Q5 hot start high-fidelity DNA polymerase (New England Biolabs)) to attach common overhangs and amplify the target locus ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR fragments were assembled using NEBuilder® HiFi DNA Assembly Master Mix (Cat. No. E2621, NEB, Ipswich, MA, USA). DNA sequences in all these plasmids were authenticated by automatic sequencing.
-
bioRxiv - Synthetic Biology 2023Quote: Plasmids purified from both t0 and t24 samples were amplified using two rounds of PCR with Q5 polymerase (New England Biolabs) to add adapters and indices for Illumina sequencing ...
-
bioRxiv - Genetics 2023Quote: ... via a 20 µL PCR that utilized the following: 10 µL Onetaq Quick-Load 2x master mix (New England Biolabs), 10 µg bovine serum albumin ...
-
bioRxiv - Genomics 2023Quote: ... we amplified the library using PCR with a 10 µl reaction mixture containing 5 µl of Phusion High Fidelity MASTER Mix (New England Biolabs), 2 µl of P1 primer (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC G) ...
-
bioRxiv - Genomics 2023Quote: Constructs encoding either a GFP or an RFP protein were PCR amplified and in-vitro transcribed from a T7 promoter with the HiScribe T7 Kit (NEB), using a mixture of ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... we quantitated the proportion of abnormal DNA fragments generated by the procedure using DNA prepared from the transfected cell population and a polymerase chain reaction (PCR)-based T7 endonuclease assay (New England BioLabs). The PCR was performed with primers flanking the predicted ligation-junction product (forward primer AGAATACCAGGGGGCCATGA and reverse primer AACGAATCCTTTCCCTGGGTC) ...
-
bioRxiv - Biophysics 2023Quote: HeR-48C12 was amplified from pBAD-Helios-NT-6xHis and combined with TSX3ER2 and Citrine using overlap-extension PCR with Phusion high fidelity master mix (NEB). The primers used for cloning are listed in the Supporting Information (SI ...
-
bioRxiv - Biophysics 2023Quote: ... DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs). Constructs were transformed and amplified in NEB 5-alpha Competent E ...
-
bioRxiv - Molecular Biology 2023Quote: ... where the band shift due to the insertion of the BSR cassette was confirmed in the case of homologous recombination and purified using a PCR purification kit (NEB), in which the nucleotide sequence was determined (Genewiz) ...
-
bioRxiv - Cell Biology 2023Quote: PCR amplification was carried out using a Q5® High-Fidelity DNA Polymerase kit (#M0491L, New England Biolabs, Ipswich, MA) using the following protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... The digested PCR product and pSubMAAP vector was then ligated together using T4 DNA ligase (New England Biolabs, Ipsiwch, MA), transformed into Top10 competent cells (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA fragments needed to assemble the constructs encoding GADD34Δ and K3L were PCR amplified using Q5 High-Fidelity DNA polymerase (NEB) from plasmid templates (gift of A ...