Labshake search
Citations for New England Biolabs :
6701 - 6750 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: The barcode-containing region was amplified from the bacterial DNA using the boiled bacterial cells in a PCR with OneTaq HS Quick-Load Master Mix (New England Biolabs) and custom primers (Supplemental Data 3) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... One microliter was used as DNA matrix to produce PCR amplicons with the Phusion High Fidelity Taq Polymerase (#M0530; NEB) and new primers (Salten-pb1-3183-F and Salten-pb1-4136-R ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR reaction was then used as a template for in vitro transcription using EnGen® sgRNA Synthesis Kit (NEB), and the MEGACLEAR Transcription Clean-Up KIT (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2024Quote: Indexed libraries were generated using the standard Illumina two-step PCR protocol using Q5 high fidelity DNA polymerase (New England Biolabs). Paired-end sequencing with a 2×250 bp read length was performed at the Bio-Environment platform (University of Perpignan Via Domitia Perpignan ...
-
bioRxiv - Immunology 2024Quote: ... Two microliters were subsequently used in real-time quantitative PCR reactions containing SYBR-green based Luna universal dye qPCR mix (New England Biolabs) and gene specific PCR primers ...
-
bioRxiv - Immunology 2024Quote: ... The PCR amplicon was purified by sequential gel extraction (1.5% agarose gel prepared in 0.5x TAE) and affinity column chromatography (Monarch® PCR & DNA Cleanup Kit, New England Biolabs). For IVT synthesis ...
-
bioRxiv - Genomics 2024Quote: ... Library amplification (10-12 PCR cycles) was carried out using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs), with IDT for Illumina UD Indexes (96x ...
-
bioRxiv - Genomics 2024Quote: ... were amplified by PCR and cloned at the ClaI site in the Rosa26-targeting vector pEN111 by Gibson assembly (New England Biolabs). The resulting vectors obtained (pEN111-TRE3G-LKF/AKF-IRES-ZsGreen1-rtta3G_Rosa26-donor ...
-
bioRxiv - Microbiology 2024Quote: Plasmids were constructed by amplifying inserts by PCR using specific oligonucleotides and the Q5 high fidelity enzyme (New England Biolabs). PCRs were purified using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel) ...
-
bioRxiv - Microbiology 2024Quote: ... AnTat1.1 sequence was obtained from AnTat1.1 specific cDNA from mouse infection D6 cloned into a pMiniT vector with the PCR Cloning Kit (NEB, E1202S). VSG-228 was partially amplified from VSG PCR (see below ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size-selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Immunology 2024Quote: ... 10 ng of restriction enzyme digested backbone and 20 ng of SPRI purified PCR variable regions were combined with an appropriate volume of 2x HiFi master mix (New England Biolabs) for one hour at 50°C ...
-
bioRxiv - Microbiology 2024Quote: ... 2 kb fragments upstream and downstream of SrcF were PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs) and cloned in PCR amplified pEx-deletion-ermG via DNA Gibson assembly (HiFi DNA Assembly Master Mix ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
bioRxiv - Biochemistry 2024Quote: ... The on- and off-target genomic sites (experimentally determined from a previous study) were PCR amplified with Phusion plus DNA polymerases (New England Biolabs) and locus-specific primers having tails complementary to the Truseq adapters ...
-
bioRxiv - Bioengineering 2024Quote: ... and mCherry inserts were generated via PCR and cloned into the linearized viral backbone as a single fusion protein using HiFi cloning mix (NEB). H2B-iRFP nuclear marker was (Addgene Plasmid #90237) ...
-
bioRxiv - Bioengineering 2024Quote: ... All PCR amplifications were performed using the Q5® High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Bioengineering 2024Quote: ... The TSA1 promoter was amplified by PCR from genomic DNA obtained from the X-33 strain using Q5 polymerase (New England Biolabs) and primers TSA1_BstBI_Fw and TSA1-GFP_Rv_KpnI ...
-
bioRxiv - Microbiology 2024Quote: ... the plasmid pME6000 was digested by HindIII and the PCR-amplified gene of interest was inserted by Gibson cloning (NEB). For this ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... the sgRNA regions were amplified from the genomic DNA by PCR using the NEBNext Q5 HotStart HiFi polymerase (NEB, M0543) and specific primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Bioengineering 2024Quote: ... input genomic DNA was amplified in a 10-μl reaction for 26 cycles using NEBNext High-Fidelity 2x PCR Master Mix (NEB). PCR products were purified using Sera-Mag magnetic beads (Cytiva ...
-
bioRxiv - Genetics 2023Quote: ... 1 ng of oligoarray library DNA was PCR amplified for 12 cycles in 40 μL reactions using Q5 High-Fidelity DNA Polymerase (NEB) and primers specific to the right or left end library ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product and pLV IRES-Hygro plasmid backbone were assembled using HiFi DNA Assembly Master Mix (NEB Cat#: M5520AA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR reactions were performed on an Applied Biosystems 7500 Real-Time PCR system using the Luna Universal qPCR MasterMix (New England Biolabs) with the primers listed in Table S4 ...
-
bioRxiv - Microbiology 2023Quote: ... and complement strains (wos2Δ::WOS2) were constructed using biolistic transformation of constructs amplified using double-joint PCR or Gibson Assembly (NEB), as previously described (primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... For library generation primers specific to the 5′ and 3′ RNA adapter sequence were synthesized (Table S1) and the whole cDNA was PCR amplified using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes [16] ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2uL of the resulting DNA was used for PCR with Taq polymerase in ThermoPol Buffer per manufacturer protocol (New England BioLabs).
-
bioRxiv - Microbiology 2023Quote: The RmlC expression constructs used in this study were constructed by PCR amplification of the rmlC alleles from strains MG1655 (rmlCWT) and BP27 (rmlCL122W) using the Q5 high-fidelity polymerase (NEB) and oligos listed in Table s1 and subsequent insertion into pBAD18-Chl via restriction digestion cloning.
-
bioRxiv - Microbiology 2022Quote: DNA extracted from faeces was used as a template for PCR amplification of a 330 bp fragment of slpA using Phusion polymerase (NEB) and RF2193 (ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTACTTGTAGCTACTTTTA TTGCAC ...
-
bioRxiv - Microbiology 2022Quote: ... double stranded library was amplified using PCR by adding 30 μL of 2X Q5 High Fidelity Master Mix (NEB M0492L), 0.4 μL of 100 μM oDS028 ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted from individual embryos by heat shock denaturation in 50 mM NaOH (95°C for 20 minutes) and used for PCR by using Q5 High-Fidelity Taq Polymerase (New England Biolabs). The presence of specific amplicons was tested by running the PCR product on 1% agarose gel ...
-
bioRxiv - Synthetic Biology 2023Quote: ... backbone fragments were generated by PCR using proof-reading polymerase (PhusionTM, ThermoFisher cat #F530 or Q5®, NEB cat #M0492). Discrete plasmids were constructed using the HiFi DNA Assembly kit (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the DNA fragments were PCR amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs Inc) following manufacturer instructions and the PCR reactions were purified using PureLink™ PCR Purification Kit (Invitrogen).
-
bioRxiv - Synthetic Biology 2023Quote: Primers (Table S1) were ordered from Integrated DNA Technologies (IDT) and constructs were PCR-amplified with Q5 High Fidelity polymerase (NEB). For all vectors ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the plasmid DNA served as template for a 50 µl PCR (Q5 High-Fidelity 2X Master Mix, NEB) with primers PK412+PK421 (input library ...
-
bioRxiv - Biochemistry 2022Quote: ... The positive clones were identified by colony PCR in a 20 μL reaction using Taq DNA polymerase with ThermoPol buffer (New England Biolabs) with PCR parameters ...
-
bioRxiv - Biophysics 2022Quote: ... The PCR product was digested by HindIII and NheI then was cloned into the digested pGJJ162 plasmid using T4 Ligase (NEB). To construct 6 KRAS BindingPCA plasmids ...
-
bioRxiv - Biophysics 2022Quote: ... 6 BindingPCA plasmids are constructed by ligating each binding partners PCR product which was digested by BamHI and SpeI to digested pGJJ317 using T4 Ligase (NEB). To construct RAF1 bindingPCA plasmid (pGJJ336) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Point mutations in pLJM1-zeo ORF29 were generated using inverse PCR site-directed mutagenesis with Phusion DNA polymerase (New England Biolabs). Primers for these reactions are listed in S3 Table ...
-
bioRxiv - Bioengineering 2023Quote: ... We then cloned both the five and ten position randomized PCR product into the pEXT20 vector using restriction digests with SacI-HF and HindIII-HF (NEB) and ligation using T4 DNA ligase (NEB at 16 °C for 16 hours with a 1:3 molar ratio of insert to vector ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... while the pML104-PDR1 vector has a guide sequence 5’- CTGGATAAACGTCGCTCCAC-3’ introduced by Q5 polymerase PCR (New England Biolabs) and In-Fusion Snap Assembly (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 75 - 150 ng of hybridized PCR products were digested with T7 endonuclease (New England Biolabs, Catalogue # M0302S) for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: IS element excision from the plasmid backbone was detected by PCR using OneTaq 2X Master Mix with Standard Buffer (NEB) and 0.2 uM primers ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR-based mutagenesis was carried out using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs®, MA, USA) as per the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products containing the RB border and the PgpdA-geneticin1-664 were digested with XhoI (New England Biolabs, UK) and ligated using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... cells by introducing either a truncation or a substitution into the parental pFE127 plasmid via site-directed PCR-based mutagenesis (KLD enzyme mix, New England Biolabs). Protein expression was induced for 4 h at 37°C by adding 1 mM IPTG when cell cultures reached OD600 nm ∼0.5 in LB with ampicillin ...