Labshake search
Citations for New England Biolabs :
6551 - 6600 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Approximately 100 ng of gDNA was used as template for PCR using Q5 Hot Start DNA Polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genomics 2020Quote: ... 10uL tagmented DNA prepared as described above was used in a 25uL PCR reaction using NEBNext High-Fidelity Master Mix (New England Biolabs) and Nextera XT Dual-Indexed primers (Nextera) ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were assembled from fragments (linearized vector, PCR products, and/or synthetic DNA) using the NEBuilder Hifi DNA assembly kit (New England Biolabs (NEB) E2621) ...
-
bioRxiv - Microbiology 2020Quote: The quantification of DWV genome copies was performed by SYBR-Green Real-Time Quantitative PCR (qPCR) using Luna Universal qPCR master mix (New England Biolabs), 0.25 μM forward and reverse DWV_qPCR primers and 2 μl of cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Plant Biology 2021Quote: ... The miR823-resistant CMT3 construct (rCMT3) was generated by PCR site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs) using the cCMT3 construct as a template to introduce six silent mutations as shown in Fig ...
-
bioRxiv - Immunology 2020Quote: ... Hhex point mutations were introduced by PCR followed by assembly using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs). Hhex truncation was introduced by PCR ...
-
bioRxiv - Plant Biology 2020Quote: ... a 417 bp fragment of the gene was amplified by PCR from a pooled CPB midgut cDNA sample using Phusion DNA polymerase (Biolabs) and cloned into L4440gtwy (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Bisulfate-treated DNA served as the template in one round (L1-Gf and L1-A) or two nested rounds (H19 and IAP) of PCR with EipMark Hot Start Taq DNA Polymerase (NEB) using the following protocol ...
-
bioRxiv - Immunology 2021Quote: ... Samples were recovered by phenol/CHCl3/isoamyl alcohol extraction twice and purified as per kit instruction using Monarch PCR and DNA cleanup Kit (New England BioLabs). DNA was suspended in 200 ul pre-warm (55°C ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Cancer Biology 2020Quote: ... We engineered the strain using a chimeric URA3::pol2P301R PCR product amplified in two fragments from pRS416-POL2 (Williams et al. 2013) with Phusion polymerase (New England Biolabs) and the following conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... A new plasmid was then created by ligating the PCR fragment and the linearized pETDuet-1 vector using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... from RNA-seq samples was used as input for PCR amplification with Phusion High-Fidelity DNA polymerase (New England Biolabs) and UPF1 specific primers that flank the regulatory loop sequence (Forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pre-gRNA cassette was PCR amplified using Q5® High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) to encode MluI and BamHI digestion sites as described in Supplementary Table S2 ...
-
bioRxiv - Immunology 2021Quote: ... 10 μl of the eluted PCR product was used in a final indexing using NEBNext Multiplex Oligos for Illumina (E7710S, NEB) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reactions were pooled and treated for 1 hour at 37°C with 250 u /ml of Exonuclease I (NEB). Libraries were purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel) ...
-
bioRxiv - Immunology 2020Quote: ... and ligation with the NotI digested PCR products was performed for 1 hour at room temperature with T4 DNA ligase (NEB). Colonies were screened by restriction digestion for the directional insertion of PCR products and the resulting lentiviral vectors were validated by Sanger sequencing.
-
bioRxiv - Immunology 2021Quote: ... The sgRNAs in each DNA sample were amplified using the two-step PCR method described previously71 using Hot Start Taq Polymerase (New England Biolabs), however in the second PCR the 8bp barcode was incorporated into the reverse as well as forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... A 523bp fragment of ERV-DC7 or ERV-DC16 env genes was then amplified by PCR using One Taq DNA Polymerase (New England Biolabs) with the following primers ...
-
bioRxiv - Immunology 2021Quote: ... 5’ loxP site was added upstream of exon 1 using a galK cassette (NCI Frederick) that was PCR amplified with LongAmp Taq DNA polymerase (NEB), followed by recombineering-based gap repair using 5’ and 3’ arms of homology and cloning into PL253 (NCI Frederick ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was digested with Not1 and EcoR1 to accept two overlapping PCR fragments and a 1Kb 3’Arm by Gibson assembly (NEB). Aplnr (NM 011784.3 ...
-
bioRxiv - Cell Biology 2021Quote: ... S.aureus Cas9 was amplified with homologous adaptors from pX601 by PCR for ligation into the pMB950 plasmid digested with NheI and XhoI (New England Biolabs).
-
bioRxiv - Genomics 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2021Quote: ... beads were resuspended in 25 μl 0.5x TT and on bead PCR for addition of Illumina-specific adapters and 10-bp Unique Dual Indexes (UDIs) using NEBNext 2X High Fidelity PCR MM (NEB) and 25 PCR cycles was performed (Figure 5-table supplement 2) ...
-
bioRxiv - Genetics 2020Quote: ... and T3 (5’-AATTAACCCTCACTAAAGGG-3’) promoter-tagged PCR fragment from each gene using corresponding T7 and T3 RNA polymerase (T3:M0378S; T7:M0251S, BioLabs). Primers used for PCR are listed in Supplemental table 1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each PCR amplification product was digested overnight at 37 °C with 2 μl of CutSmart® uffer (New England Biolabs) and 0.2 μl of AccI enzyme (10 U/mL ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR products as well as Borrelia shuttle vector pBSV2-G were digested with XmaI and XbaI and the resulting PCR product and pBSV2-G backbone were ligated together using T4 DNA Ligase (New England Biolabs), followed by subsequent transformation into E ...
-
bioRxiv - Microbiology 2022Quote: ... PCRs purified using the Nucleospin gel and PCR clean-up kit were cloned into plasmid backbones digested with restriction enzymes (NEB) using the In-Fusion HD cloning system (Takara) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The locus-specific HDR donors were generated by PCR amplification of the MACHETE bicistronic cassette using a high-fidelity DNA polymerase (Herculase II, Agilent or Q5, NEB). PCR fragments were column purified (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... 3.75 μl (corresponding to ~7,500 cells) of lysate was used as a template for PCR amplification with Q5 Hot-Start High Fidelity DNA Polymerase (NEB) and unique primer pairs containing an internal locus-specific region and an outer Illumina-compatible adapter sequence ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplification was carried out using NEB Q5 High Fidelity 2x Master Mix (New England Biolabs Inc., Ipswich, Massachusetts, USA). The PCR reaction consisted of 2.5 ul each of 10 μM Forward and Reverse Primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplicons were verified by agarose gel electrophoresis and purified using the Monarch PCR and DNA Cleanup Kit (New England Biolabs). In vitro transcription was performed using the T7 RiboMAX Express Large Scale RNA Production System (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ninety-six 12 μl Gibson reactions were performed in 96-well PCR plates using Gibson Assembly Master Mix (NEB E2611L). The Gibson reaction mix was transformed into Mach1 competent cells (4 μl Gibson into 40 μl cells ...
-
bioRxiv - Bioengineering 2022Quote: All gene amplifications were performed using polymerase chain reaction (PCR) in a 50 µL mix with Q5 High-Fidelity DNA Polymerase (New England Biolabs) according to the manufactureŕs protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... HiScribe T7 RNA polymerase kits and Q5 2x HiFidelity PCR mastermixes were purchased from New England Biolabs (NEB, Ipswitch, MA). Sodium cacodylate solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... genome-integrated sgRNA sequences were then amplified by PCR using Q5 Mastermix Next Ultra II (New England Biolabs, Cat# M5044L), with primers v2.1-F1-5’ GAGGGCCTATTTCCCATGATTC 3’ and v2.1-R1-5’ GTTGCGAAAAAGAACGTTCACGG 3’ ...
-
bioRxiv - Genomics 2022Quote: ... After 25 cycles of amplification the product was purified with the Monarch PCR&DNA Cleanup kit (New England BioLabs T1030L) and eluted with 20 μl of ddH2O ...
-
bioRxiv - Biochemistry 2022Quote: ... 100 ng of each gel-purified PCR products (total of 19) were mixed and digested with BsmBI restriction enzyme (NEB) for 2 h at 55 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... PDGFRβ DNA inserts containing the desired mutations were generated by PCR amplification using the Phusion High-Fidelity DNA Polymerase (New England Biolabs) and subcloned into pLenti CMV Hygro DEST for cellular studies ...
-
bioRxiv - Biochemistry 2022Quote: ... KIT DNA inserts containing the desired mutations were generated by PCR amplification using the Phusion High-Fidelity DNA Polymerase (New England Biolabs). The inserts were subcloned into either pFastBac 1 vector for structural studies or pBABE-puro vector for cell-based studies ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 244 bp portion of APOE was amplified using standard PCR protocols and digested simultaneously with AflIII (R0541) and HaeII (R0107) restriction enzymes (New England Biolabs) for at least two hours at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μL supernatant in a total reaction volume of 20 μL was used as template and PCR was performed using Q5 polymerase (NEB). Primers are listed in Table S1 ...
-
bioRxiv - Cancer Biology 2022Quote: PCR products were amplified from the specified genomic DNA samples with Q5 High-Fidelity 2X Master Mix (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: The DNA templates for the different RNA designs were produced by PCR amplification using Phusion High-Fidelity DNA polymerase (NEB) of double stranded gene fragments (gBlocks ...
-
bioRxiv - Bioengineering 2022Quote: Genomic DNA samples were amplified with PCR using Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs M0494). Primer pairs for all sequences are listed in Table S3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and containing the sequence DuxblExon 5-iRFP702-Duxbl3’UTR after amplifying the corresponding sequences by PCR followed by Gibson assembly (New England Biolabs) (Supplementary Table 8) ...
-
bioRxiv - Developmental Biology 2022Quote: ... musculus was cloned into the pOPIN expression vector using the SLIC method and Phusion Flash High-Fidelity PCR Master Mix (Finnzymes/New England Biolabs). SLIC reactions were then transformed into One Shot™ OmniMAC™ 2 T1® Chemically Competent E ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5ml of the cleaned transposed DNA was used for library amplification (12 cycles) using the NEBNext HiFi 2X PCR Master Mix (New England BioLabs) and previously designed ATAC-seq barcoded primers (Supplemental Table 4 ...