Labshake search
Citations for New England Biolabs :
6301 - 6350 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Bioengineering 2021Quote: ... Synthesized library inserts 1-16 were mixed in equimolar ratios and extended to the XbaI recognition site on the pET backbone using Q5 PCR (NEB) with the library insert as a template and XbaI extension and common reverse as primers (Supplementary Table 5) ...
-
bioRxiv - Microbiology 2021Quote: ... All primers (Supplementary Table 2) were purchased from Eurofins Genomics and all PCR reactions were performed using Q5 High-Fidelity (New England Biolabs). HIV-1NL4-3 (pHIV-1WT ...
-
bioRxiv - Biochemistry 2020Quote: ... Human wild-type TDP-43 was amplified in two separate PCR reactions excluding the NLS and reassembled using Gibson cloning (NEB) into a Doxycycline-inducible expression vector containing an N-terminal mClover3 tag ...
-
bioRxiv - Biochemistry 2020Quote: ... The entire mDHFR ORF was PCR amplified from a mDHFR plasmid with a C-terminal AviTag fused to the mDHFR fragment using Gibson Assembly (NEB). The backbone contained a T7 promoter ...
-
bioRxiv - Biophysics 2021Quote: ... Hybridization reactions were split into two and libraries re-amplified using Post LM-PCR oligos (Nimblegen) and Q5 High-Fidelity DNA polymerase (NEB) directly from the beads ...
-
bioRxiv - Neuroscience 2021Quote: ... genomic PCR products containing the target sites of selected gRNAs were incubated with SpCas9 protein (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol and analyzed on 2% agarose gel stained with ethidium bromide ...
-
bioRxiv - Microbiology 2021Quote: ... difficile strain 630 genomic DNA and purified PCR products were directly cloned into the PmeI site of pMSR vector using NEBuilder HiFi DNA Assembly (New England Biolabs). All pMSR-derived plasmids were initially transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids to express Flag-tagged and HA-tagged proteins were created by changing the Myc-coding sequence in pCMV-Myc expression plasmids to intended tag-coding sequence using inverse PCR and NE Builder HiFi Assembly (New England BioLabs), respectively.
-
bioRxiv - Biophysics 2020Quote: ... along with the purified PCR fragment was digested with EcoRI and XbaI then ligated together with T4 DNA ligase (M0202, New England Biolabs). pENTR1a-3xNLS-mScarlet-I was then recombined using Gateway LR Clonase II (11791 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μL of the diluted PCR product was amplified in a 20 μL barcoding reaction that included 1X NEBNext Phusion Master (NEB) and 4 μL of the Fluidigm Access Array barcoding primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... We performed eight 100 µl PCR reactions per sample (4 µg DNA per reaction) using Q5 High-Fidelity 2x Master Mix (New England Biolabs)28 to maximize library sequencing quality ...
-
bioRxiv - Cell Biology 2021Quote: ... CK1γ3 kinase dead mutants were generated using PCR mutagenesis and cloned into pDONR223 digested with BsrGI using Gibson Assembly Master Mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Neuroscience 2020Quote: ... The randomization of LCDR3 and HCDR2 was performed by two PCR steps using Phusion High Fidelity DNA polymerase (NEB Biolabs). A first randomization PCR was performed using randomized primers (a forward primer to randomize LCDR3 and a reverse primer to randomize HCDR2) ...
-
bioRxiv - Neuroscience 2020Quote: ... The randomization of LCDR3 and HCDR2 was performed by two PCR steps using Phusion High Fidelity DNA polymerase (NEB Biolabs). A first randomization PCR was performed using randomized primers (a forward primer to randomize LCDR3 and a reverse primer to randomize HCDR2) ...
-
bioRxiv - Biochemistry 2021Quote: ... The guide RNA target site was amplified from transfected cells and analyzed by T7 Endonuclease I digestion of re-annealed PCR products (New England Biolabs). The guide RNA eventually selected for genome editing in embryos was Bahd1-sg47B (protospacer sequence 5’-GCCTGTAATACCACAGG −3’) ...
-
bioRxiv - Biochemistry 2020Quote: ... the truncated CNNM2 PCR products were cloned into the pCINE-IRES-GFP vector by digestion with restriction enzymes NheI (New England Biolabs) and XhoI (New England Biolabs).
-
bioRxiv - Plant Biology 2021Quote: ... and the 3’ UTR sequence (310 bp downstream of the stop codon) were amplified by PCR using Phusion DNA polymerase (NEB) from genomic Col-0 DNA with IRT1p_-1024F 5’- CACCGACACATTAAACATTCATACCCGATT-3’ and IRT1_1546R 5’- CTTTAATTTACTTATCTTGAAAAAGCAGC-3’ ...
-
bioRxiv - Plant Biology 2020Quote: ... The full-length SpG was assembled using the overlapping-extension PCR-based method with the high-fidelity DNA polymerase Phusion (NEB) and the primers listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... 17 μl of the PCR reaction were mixed with 2 μl of CutSmart Buffer and 1 μl of AvaI (NEB) for a final volume of 20 μl ...
-
bioRxiv - Systems Biology 2020Quote: ... Appropriate restriction sites were either included in custom synthesized oligonucleotides (IDT) or introduced by PCR with Q5 High-Fidelity Polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutation of Cys324 to alanine was achieved by site directed mutagenesis by inverse PCR using Q5 high fidelity DNA polymerase (New England, BioLabs), pET28-PnpA as template and primers (5’-GCCTCTGGTTTATTAAAAAGGTTATTCAGC-’3 and 5’-ATCATTATTGAAATCCATTCCCCC-’3) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The double-stranded template was produced by annealing the strands and filling in the single-stranded regions with Phusion HF PCR Master Mix (NEB) by cycling between the melting temperature of the strands and 72°C twenty times ...
-
bioRxiv - Neuroscience 2020Quote: ... and Genomic DNA was isolated and subjected to PCR to amplify the 433 bp fragment containing gRNA target sequence using Q5 High Fidelity DNA polymerase (NEB) and primers (GAATTC(EcoRI)/GAGTTCTAGTGTCAGAAGAAAAAAGATGAATTTTATTCC and GGATCC(BamHI)/AGCTTTAATAGTGTGCAGGGTCAGTCAG) ...
-
bioRxiv - Microbiology 2020Quote: ... After bead purification half of the DNA elute was used for a 50-µl PCR reaction containing the NEBNext High-Fidelity 2x Master Mix (NEB), 25 pmol ...
-
bioRxiv - Plant Biology 2020Quote: The cDNA encoding the full length AtHMA4 protein or the cDNA encoding the 473 amino acid AtHMA4 C-terminal domain was amplified from previously generated AtHMA4 cDNA plasmids (Mills et al., 2010) by PCR using Phusion High-Fidelity DNA polymerase (New England Biolabs). The primers AtHMA4FL-F (5′-ACTGGATCCCTCTCAACCTTTATCTGAT-3′ ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed 4 PCRs per pool from cDNA and gDNA respectively using the Q5 High Fidelity 2X Master Mix (New England Biolabs), then pooled the PCRs and purified them ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2020Quote: ... Obtained PCR product (531 bp) and pRSF-NT vector were digested with NcoI-HF and HindIII-HF (New England BioLabs) and ligated using T4 DNA ligase (New England BioLabs) ...
-
bioRxiv - Systems Biology 2020Quote: ... We neutralized the tagmentation activity of Enzyme 1 by immediately cleaning the reaction with the Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... a 6.5-kbp promoter region was incorporated into pDONRP4-P1R by assembling four PCR fragments with the Gibson Assembly technology (New England BioLabs). The protocol for the Gibson assembly ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions were performed with 15 μL Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA), 0.2 μM of forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was ligated to a low-copy plasmid vector pWSK29 (BamHI/Sall) by Gibson assembly (New England Biolabs). Similarly ...
-
bioRxiv - Microbiology 2020Quote: ... column purified (QIAquick PCR Purification kit) and ligated with restriction enzyme cut-pHH21 using T4-ligase (New England Biolabs, NEB). Ligation products were transformed into DH5a (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... column purified (QIAquick PCR Purification kit) and ligated with restriction enzyme cut-pHH21 using T4-ligase (New England Biolabs, NEB). Ligation products were transformed into DH5a (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR products were inserted into pSN054 cut with FseI and I-SceI respectively via Gibson Assembly (New England Biolabs). The recodonized Pf3D7_1437000 gene was synthesized by GENEWIZ (South Plainfield ...
-
bioRxiv - Microbiology 2021Quote: ... Regions of 16S rDNA gene were amplified by PCR from extracted DNA with the Q5 high-fidelity DNA polymerase (New England BioLabs) using the universal primers 926F ...
-
bioRxiv - Microbiology 2021Quote: ... The Transposon-gDNA junctions were prepared for sequencing by PCR addition of Illumina adapters using the NEBNext Multiplex Oligos for Illumina (New England Biolabs). However ...
-
bioRxiv - Microbiology 2021Quote: ... The three PCR products were assembled as one large fragment (5’ cynX - insert - lacA3’) by Gibson Assembly (New England Biolabs). The assembled DNA was transformed into electrocompetent WT E ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was amplified and indexed using the PCR Barcoding Kit (Oxford Nanopore Technologies) and LongAmp Taq 2X master mix (New England Biolabs). The resulting cDNA libraries were sequenced on a MinION (MIN101B ...
-
bioRxiv - Microbiology 2021Quote: ... a 1kb fragment up- and downstream of the target gene was amplified via PCR and cloned into the pMQ30 plasmid using Gibson cloning (NEB) and transformed into E ...
-
bioRxiv - Microbiology 2021Quote: ... a kanamycin cassette bookended with FRT sites from plasmid pKD4 with 60-bp homology to the upstream and downstream region of mgrB was PCR amplified using high fidelity Q5 polymerase (New England BioLabs [NEB]). The purified PCR product was then electroporated into the target strain (AZ63 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR to amplify the barcode region was performed in 2ul of boiled cells using Phusion DNA polymerase (New England Biolabs). The presence of the correct PCR product was verified on an agarose gel and samples were pooled ...
-
bioRxiv - Neuroscience 2020Quote: ... each round of evolution also included a library created by gene-shuffling the selected clones using the staggered extension PCR method [20] and Taq polymerase (New England Biolabs). The amplified DNA fragments were inserted into the constitutive bacterial expression vector pNCS (gift from Nathan Shaner ...
-
bioRxiv - Microbiology 2021Quote: ... PCR/reaction cleanup and gel extraction were conducted with the Monarch PCR and DNA cleanup kit and Monarch DNA gel extraction kits (NEB). E ...
-
bioRxiv - Microbiology 2021Quote: ... was digested with NotI and NheI and the mgrB PCR product was cloned using the NEBuilder HiFi DNA assembly kit (NEB), followed by transformation into the E ...
-
bioRxiv - Immunology 2021Quote: ... the pCMV3-SΔ19 insert was initially digested with KpnI and blunt polished using Phusion Taq polymerase followed by a DNA cleanup using the Monarch PCR cleanup kit (NEB) and a second digest was done using NotI ...
-
bioRxiv - Microbiology 2021Quote: ... Restriction enzyme-cut pTOX3 was incubated with purified AB and CD PCR products along with a half-reaction of HiFi DNA Assembly Master Mix (NEB) according to manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The vector and the PCR insert were used to prepare 4 ligation reactions by mixing with T4 Ligase (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... DNA amplicons for HA and PA gene segments with partial sequencing adapters were generated via PCR amplification of cDNA using the Phusion High-Fidelity DNA Polymerase (New England BioLabs) and gene segment specific primers (Supplementary Table 1) ...