Labshake search
Citations for New England Biolabs :
5551 - 5600 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... the PCR product and the pDRF1-GW plasmid were digested using BamHI-HF and NheI-HF (New England Biolabs, Ipswich, MA) and the PCR product was ligated into the plasmid using T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... ERCC-00048 DNA with an upstream T7 promoter was cloned into pUC19 and PCR amplified (primers in Table S9) with Phusion polymerase (New England Biolabs M0530S) using the following cycling conditions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... An insert for the EF1alpha promoter – i7pB transgene –bGH poly(A) signal was chemically synthesized and assembled using overlapping PCR products into pUC19 (GenBank: L09137, New England Biolabs, #N3041). All plasmid preparation services (chemical synthesis of DNA insert sequences ...
-
bioRxiv - Microbiology 2022Quote: ... The standard curve was created from PCR product generated using the inovirus primer set (above) and a Phusion® High-Fidelity DNA Polymerase (NEB) using extracted DNA from each strain as a template ...
-
bioRxiv - Microbiology 2022Quote: ... The sequencing ladders were obtained from hlgCB or hlgB PCR products (amplified with primers listed in Supplementary Table S2) and the Vent (exo-) DNA polymerase (NEB Biolabs). All samples were fractionated on a 10% polyacrylamide −8 M urea gel in 1x TBE ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of the heated solution was then used as template for PCR using the Q5® High-Fidelity DNA Polymerase (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL was used as input in a second round PCR amplification to attach Illumina adaptors and dual index primers (NEB, E7600S) for five PCR cycles using Q5 HotStart-High-Fidelity 2X Master Mix with an annealing temperature of 65°C for 20 seconds and an extension time of 1 minute ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR reactions were performed with a final primer concentration of 1 mM using Q5® High-Fidelity 2X Master Mix (NEB). Equal volumes of X and Y PCR reactions were then combined ...
-
bioRxiv - Neuroscience 2023Quote: ... PCRs to confirm targeted and untargeted SMN2 loci were performed for each of the cell lines with primer pairs shown in table 1 using High-Fidelity 2X PCR Master Mix (NEB, M0541L) and Thermal Cycler C1000 Touch (Bio-RAD) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL was used as input in a second round of PCR to attach on Illumina adaptors and dual index primers (NEB, E7600S) for five PCR cycles using Q5 HotStart-High-Fidelity 2X Master Mix with an annealing temperature of 65°C for 20 seconds and an extension time of 60 seconds ...
-
bioRxiv - Systems Biology 2023Quote: ... was decided by calculating the cycle threshold value from a qPCR reaction using the NEBNext Q5 Hot Start HiFi PCR Master Mix (NEB #M0543L) for the specified cDNA concentration ...
-
bioRxiv - Immunology 2022Quote: ... the PCR products were denatured and slowly re annealed to form hetero-duplex DNA and digested with T7 endonuclease (NEB, Germany) for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: The coding region for OspA with its native intergenic promotor was amplified by PCR with Q5 thermostable high-fidelity polymerase (NEB, M0491) from B31-e2 genomic DNA with primers 35 and 36 (Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the previously published pFF-12 as a template.18 Insert assembly and ligation into PCR-linearized pJAK184 (FFO-362/-363) was achieved via Gibson Assembly (Gibson Assembly ® Master Mix, New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 µL of the supernatant was used as a template for the PCR reaction using OneTaq® 2X Master Mix with Standard Buffer (New England Biolabs) primers 4925 and 4926.
-
bioRxiv - Molecular Biology 2022Quote: ... were produced by a PCR-mediated site-directed mutagenesis protocol(Carey et al, 2013) using the Q5 DNA polymerase (New England Biolabs Laboratories) or KOD Hot start (Merck) ...
-
bioRxiv - Plant Biology 2022Quote: ... the full region including the HrpL box promoter was PCR-amplified using primers (Supplementary Table S2) and Q5 High-Fidelity DNA Polymerase (NEB, USA). The resulting PCR fragment was gel-purified and was blunt-end-ligated into the Eco53kI (NEB ...
-
bioRxiv - Physiology 2022Quote: To identify the molecular lesion in the hyds-2 strain a 9KB PCR fragment of the ZK795.1 gene was cloned into the PUC19 plasmid by Gibson assembly (New England Biolabs, Ipswich, MA). The seaEx22 plasmid along with a myo-2:mCherry (PCFJ90 ...
-
bioRxiv - Systems Biology 2024Quote: ... we directly engineered the pre-barcoded pSL51 and pre-barcoded pSL737 plasmid pools using PCR and HiFi in vitro recombinational assembly (NEB reagents) to generate a construct that should express a single methionine start-codon fused to the Gateway attL2/attR2 “scar” sequence (YPAFLYKVV) ...
-
bioRxiv - Immunology 2024Quote: ... A total of 1µg of the purified PCR product was used for in vitro transcription using the HiScribe T7 High Yield RNA synthesis (NEB E2040S), as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting products were pre-amplified in a 100 μL reaction using 10 cycles with 4 μL pre-amp primers (10x Genomics PN 20002714) and 50 μL of NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S). Reactions were cleaned with 1.6X SPRI and eluted in 40 μL EB ...
-
bioRxiv - Microbiology 2024Quote: ... the PCR cocktail mix (25 µl) consisted of 12.5 µl OneTaq® Quick-Load® (2x Master mix; New England Biolabs), 1.5 µl each of forward (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed in a 50 μl volume containing Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs). Quantitative analysis of the purified libraries was performed using Qubit 3.0 Fluorometer and Qubit® dsDNA HS Assay kit (InvitrogenTM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was then used for PCR with the OneTaq 2x Master mix with Standard Buffer (New England Biolabs, Ipswich, Massachusetts). Targets for differential editing of the mutant in p150 and p110 were ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification of 4 µl circularized cDNA was performed in a reaction volume of 48 μl in the presence of 500 nM PCR forward primer (AATGATACGGCGACCACCGAGATCTACA*C, where * is a phosphorothioate bond) and indexed NEBNext® Multiplex Oligoes for Illumina (NEB), 0.48 U KAPA HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification of NSG2 was carried out using Q5 DNA polymerase according to the manufacturer’s recommendations (New England Biolabs, Ipswich, MA). The following primers were used to determine specific allelic expression ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR reaction was carried out in the volume of 50 µL including 25 µL 2X OneTaq Master Mix (NEB, #M0482), 2 µL of 5 µM i5 and i7 each ...
-
bioRxiv - Genomics 2024Quote: ... was PCR-amplified using the primer pair P11-P12 and assembled to the PCR-amplified pDR111 (using P3 and P4) using the HiFi DNA assembly protocol (New England Biolabs, USA). This resulted in cloning the polC mut-1 allele under the control of Phsinto a B ...
-
bioRxiv - Genomics 2024Quote: ... The 5’ extensions of P5 and P6 then allowed the assembly of the mutL(N34H) allele with the PCR-amplified pDR111 using the HiFi DNA assembly protocol (New England Biolabs, USA). This resulted in cloning the mutL(N34H ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 μL of PCR product was added to a 10 μL reaction containing 0.2 μL DraI (New England BioLabs, MA, USA) and 1 μL rCutSmart™ Buffer (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: PCR amplicons were tested for the presence of mutations using a T7 endonuclease I assay (New England Biolabs®, Ipswich, USA). 10 μL of each PCR was subjected to electrophoresis on a 1% agarose gel according to the protocol below ...
-
bioRxiv - Microbiology 2023Quote: ... hcp and tssB flanking regions were PCR-amplified from CFBP13503 with the Phusion High-Fidelity DNA polymerase (New England Biolabs, France), and the primer pairs listed in Table S2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two microliters of digested samples were used to run the reaction of PCR with Taq 2X Master Mix (New England Biolabs (UK) Ltd ...
-
bioRxiv - Cell Biology 2024Quote: The plasmids used in this study were obtained from the sources as noted in Table 2 or made by either restriction digest and ligation or PCR and NEBuilder HiFi DNA assembly (New England Biolabs E5520S). Insert sequences were ordered as custom GeneBlocks from IDT or isolated from existing plasmids ...
-
bioRxiv - Genetics 2024Quote: ... Each of the four cDNA products was then used as a template in a PCR with the same primers and Phusion® High Fidelity DNA Polymerase (New England Biolabs). All primer pairs were located within the 5’- and 3’-UTRs of the transcripts so that they amplified the entire protein coding sequence of the respective genes (Figure 1 ...
-
bioRxiv - Genetics 2024Quote: ... DNA was isolated from HepG2 cells and the regions were amplified with PCR primers containing restriction enzyme (RE) cutting sites for NsiI (New England Biolabs, NEB) and BamHI/HindIII (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Both libraries were ordered as synthesized oligo pools (Integrated DNA Technologies) and PCR-amplified with Q5 DNA polymerase (New England Biolabs M0492) using an optimized two-round amplification strategy to minimize barcode-sgRNA recombination ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we first confirmed the presence of mutations in the gene coding for pb1 in evolved phage populations by sequencing (Sanger; Eurofins, Nantes, France) the amplicon obtained from PCR using Q5 high-fidelity DNA polymerase (#M0491; New England Biolabs NEB) and the primers Salten-pb1-3183-F / Salten-pb1-4136-R primers (TableS1) ...
-
bioRxiv - Genomics 2024Quote: Two microliters of the cDNA were used for PCR amplification employing Taq polymerase (Genaxxon Bioscience) for HEK293T-derived samples and Q5® High-Fidelity DNA Polymerase (New England Biolabs). Primers are listed in Supplementary Table 5 ...
-
bioRxiv - Genomics 2024Quote: ... The cDNA was then used as input for the first-round PCR with oJL105 and oJL106 to add the i5/i7 primer sites using Q5 DNA polymerase (NEB M0491L). Libraries were amplified with an initial 98 °C denaturation step for 30 s ...
-
bioRxiv - Genomics 2024Quote: The gRNA libraries were amplified from each gDNA sample across 100 μL PCR reactions using Q5 hot start polymerase (NEB, M0493) with 1 μg of gDNA per reaction ...
-
bioRxiv - Genomics 2024Quote: ... Amplicons were then barcoded for NGS by combining 2 µL of amplicon from the previous PCR with 1X Q5 High-Fidelity Master Mix (New England Biolabs M0492) and 500 nM forward and reverse indexing primers (Integrated DNA Technologies) ...
-
bioRxiv - Genetics 2023Quote: ... oligonucleotide pools were amplified by 8 to 10 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544X), digested with BstXI and BlpI ...
-
bioRxiv - Microbiology 2024Quote: ... the purified PCR products were ligated with the empty vectors in a molar ratio of 1:4 using T4 DNA ligase (NEB, USA) at 16 °C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... in vitro transcription templates were prepared via 8 cycles of PCR using 2x Q5 Master Mix (New England Biolabs, Cat. M0492S) with a T7 promoter containing forward primer as previously described ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
bioRxiv - Cancer Biology 2024Quote: 3’-UTRs from mRNAs of interests were cloned using RT/PCR into the pMIR-REPORT™ miRNA Expression Reporter Vector System (Firefly Luciferase) using NEBuilder HiFi DNA Assembly (New England BioLabs). PCR amplification primers are listed in Table S1 ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... the whole shuttle plasmid was PCR-amplified with overlapping primers containing the desired insert and recircularised by NEBuilder (New England Biolabs, #E2621L) recombination.
-
bioRxiv - Microbiology 2023Quote: ... Each sample was amplified in triplicate 25 μl reactions consisting of primers at final concentrations of 0.2 μM and 1X PCR reagent (Q5® Hot Start High-Fidelity 2X Master Mix, New England BioLabs, UK). Triplicate PCR reactions for each sample were then pooled and purified using Agencourt® AMPure® XP beads (#A63881 ...
-
bioRxiv - Microbiology 2023Quote: ... The AvcI DNA template for in vitro transcription was PCR amplified from pAvcI using Q5 High-Fidelity DNA Polymerase (NEB™). To incorporate the T7 promoter into the final AvcI DNA template ...