Labshake search
Citations for New England Biolabs :
5601 - 5650 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... pCS2+ backbones containing ACVR1 or an FOP-ACVR1 mutant were PCR amplified with the mutant primer using Phusion high fidelity polymerase (NEB, M0530). Mutated plasmids were transformed into Top10 chemically competent cells and DNA from individual colonies was submitted for Sanger sequencing ...
-
bioRxiv - Genomics 2023Quote: ... DNA fragments were further size-selected by agarose gel elution and PCR amplified for 6 to 8 cycles using Illumina P1 and Index primer pair and Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The final library was purified using Agencourt AMPure XP beads and quality assessed by Agilent Bioanalyzer 2100 (DNA 7500 kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The 3xNLS-mScarlet-I insert was synthesised as a gblock (Genewiz) and PCR amplified (New England Biolabs, M0515, Q5 Hot start) with primers FW 5’- CCACCGGCCGGTCGCATGCCAAAAAAGAAGAGAAAGGTAGACC -3’ and RV 5’- TCGAGTGCGGCCGCTTTATTTCTTTTTCTTAGCTTGACCAGCTTTCTT -3’ to create overhanging microhomologies ...
-
bioRxiv - Synthetic Biology 2023Quote: All the plasmids were generated Gibson assembly59 by relying on gene synthesis and PCR using Q5 master mix DNA Polymerase (New England Biolabs, USA) with 40-bp homology domains ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified PCR products and the destination vector pSIN-TRE3G-GFP-miRE-PGK-Neo were digested with XhoI/EcoRI 37°C for 1 h and the PCR product was ligated into the destination vector using T4 DNA ligase (NEB, # M0202L) overnight at 16 °C.
-
bioRxiv - Genomics 2023Quote: Library oligos for the MYC enhancer screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... The odf3l2a template was amplified from total RNA with T3 and T7 sites on the forward and reverse primers respectively and the DIG-labeled antisense probe was synthesized directly from purified PCR product using T7 RNA polymerase (NEB M0251S). The ankef1a and saxo2 probe templates were amplified from total RNA with gene specific primers and cloned into the pCR4-TOPO vector (Thermo Fisher 450071) ...
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Bioengineering 2023Quote: ... The MAAP-WT2 DNA sequence was isolated from the AAV2 genome by Q5 Polymerase-based PCR (New England Biolabs, Ipswich, MA) and cloned into pSubMAAP to assess MAAP effects of MAAP knockout and reconstitution (Figures 1A-F and 2A-F) ...
-
bioRxiv - Microbiology 2023Quote: ... The unique barcoded region was amplified from 500ng genomic DNA with 16 cycles of PCR using NEBNext Ultra II Q5 master mix (NEB M0544L) as described in30 ...
-
bioRxiv - Immunology 2023Quote: ... The mRuby-OAS3 CDS and mRuby2 were amplified via PCR and primers (Supplemental table 1) and inserted into pLenti-PGK-PuromycinR via Gibson assembly (New England Biolabs: E2611S). The pLenti-mRuby2-PABPC1 is described in Burke et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... and the integrated sgRNA library was amplified from the genomic DNA by PCR using Q5 Hot Start High-Fidelity 2x Master Mix (NEB #M0494L) and oligos ol3 and ol4 (Supplementary Table 1) ...
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was purified by phenol-chloroform extraction and used for in vitro transcription using SP6 RNA-polymerase (NEB, M0207). The resulting sgRNA was purified using the High Pure PCR Cleanup Microkit (Roche ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Oligonucleotides were synthesised by Macrogen (Seoul, South Korea) and PCR amplification performed using Phusion polymerase (New England Biolabs; Ipswich, MA, USA) unless otherwise stated ...
-
bioRxiv - Genetics 2023Quote: ... the PCR products containing the geneticin1-664-PgpdA-RB and the SpecR-Ori were digested with SapI (New England Biolabs, UK) and ligated with T4 DNA ligase ...
-
bioRxiv - Genomics 2023Quote: ... Beads were washed with 200 μl buffer EB and resuspended in 400 μl of Post-TdT PCR mix (1x NEBNEXT Ultra II Q5 Master Mix (NEB, M0544L), 0.5 μM post-TdT-poly(C)12-S Primer ...
-
bioRxiv - Microbiology 2023Quote: ... Resolved strains (GFP-negative and kanamycin-sensitive) were tested for the desired genotype by colony PCR (OneTaq® 2X Master Mix with Standard Buffer, New England Biolabs). All the plasmids are listed in Table 2.
-
bioRxiv - Synthetic Biology 2023Quote: ... mAmetrine was inserted in place of GFP in both pDawn and pDusk plasmids via PCR and Gibson assembly (NEB HiFi mix). Using the same method ...
-
bioRxiv - Biophysics 2023Quote: We digested the phosphorylated strand by incubating each μg of the above obtained PCR product with 2.5U λ-exonuclease (NEB, M0262L) in 100 μl 1X reaction buffer at 37 °C for 1 hour followed by a 30 min heat-inactivation step at 75 °C ...
-
bioRxiv - Biophysics 2023Quote: ... colonies carrying correct clones were identified by colony PCR using OneTaq® Hot Start Quick-Load® 2X Master Mix (NEB), and plasmids were purified from overnight culture in LB containing 150 μg/ml ampicillin at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA barcodes were amplified by PCR using the gDNA from at least 6 mio cells as template and Phusion (NEB M0530) as polymerase ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR sgRNA resistant synonymous or functional domain point mutations were introduced by PCR mutagenesis using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2631). Stable cell lines were generated using the pLU vectors and selected with puromycin or blasticidin ...
-
bioRxiv - Genomics 2022Quote: ... The enhancer was amplified by PCR to add overhangs to the backbone vector (GWLP P29-30) and assembled into the backbone by HiFi Assembly (NEB #E2621).
-
bioRxiv - Genomics 2022Quote: ... signal constructs were amplified by PCR from different plasmids and assembled using the NEBuilder HiFi DNA Assembly Master Mix (HiFi Assembly, NEB #E2621). The BxbI attP site was then added using the Q5 Site-Directed Mutagenesis Kit (Q5 SDM ...
-
bioRxiv - Genetics 2023Quote: ... Knockout of the genes was confirmed by running PCR reactions using Q5® High-Fidelity DNA Polymerase (NEB, cat no. M0491) and the following primers on a 2.5% agarose gel:
-
bioRxiv - Genetics 2023Quote: ... The GAL1p promoter was amplified by PCR from genomic DNA and assembled into NcoI and SpeI digested pML107 using the HiFi DNA Assembly mix (NEB # E5520). The gRNA scaffold sequence was further modified to replace the SwaI and BclI fragment with a BaeI fragment from pML107 by HiFi Assembly.
-
bioRxiv - Microbiology 2022Quote: ... The PCR reaction volume used was 50 μl: 0.2 μl of Q5® high-fidelity DNA polymerase (New England Biolabs, UK), 10 μl of Q5® reaction buffer (5X ...
-
bioRxiv - Genomics 2023Quote: ... Multiplex-polymerase chain reaction (PCR) was performed in two separate reaction mixes prepared by combining 5 μl of 5X Q5 Reaction Buffer (NEB, M0493S), 0.5 μl of 10 mM dNTPs (NEB ...
-
bioRxiv - Immunology 2023Quote: ... The PfTrxBamA/ECL4 Mexico A construct was generated by reverse PCR using Q5 Hot Start High-Fidelity DNA polymerase (New England Biolabs, Inc.) in a 25 μl reaction containing 100 ng of PfTrxBamA/ECL4 (Nichols ...
-
bioRxiv - Genomics 2023Quote: ... was cloned between residues 34 and 35 with primers ag424 and ag425 using inverse PCR with Q5 polymerase (New England Biolabs, NEB).23 The sequences of all primers used in this study are presented in Table S2 ...
-
bioRxiv - Genomics 2023Quote: ... 21 µl of DNA was mixed with 2 µl of universal i5 and i7 primers (Buenrostro et al. 2015) and 25 µl of NEBNext HiFi 2X PCR master mix (NEB #M0544). Samples were amplified in a thermocycler as follows ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All Streptomyces colony PCRs were performed using Q5® High-Fidelity DNA Polymerase with GC Enhancer (New England BioLabs Inc., U.S.A).
-
bioRxiv - Bioengineering 2023Quote: ... Specific donor sequences for small edits were encoded in primers and substituted into the RT-DNA-encoding region of the ncRNA with a PCR and KLD reaction (NEB M0554). Donor sequences for larger insertions were cloned through Gibson assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... full-length CTPS1 and CTPS2 cDNAs were obtained by PCR as previously described [26] using the Q5® High-Fidelity DNA Polymerase (New England Biolabs). For CTPS1 ...
-
bioRxiv - Immunology 2023Quote: ... The sequence flanking the SHP2 sgRNA target site was amplified by PCR from 100 ng of genomic DNA using Q5 DNA polymerase (NEB; M0491L) and the primers ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNAs were diluted 1:10 and 2 μl of each used for subsequent PCR reactions with one unit of Taq polymerase (New England Biolabs, MA), 200uM dNTPs (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: F1 dumpy and/or non-dumpy animals were isolated from dumpy jackpot plates and genotyped by PCR and restriction digestion using HpyCH4IV (F180Δ, NEB R0619), HinfI (G199S ...
-
bioRxiv - Microbiology 2023Quote: ... The fragments containing Himar transposons were enriched with a two-step nested PCR strategy using Q5 DNA polymerase with GC enhancer (New England Biolabs, M0491) using primers (Table S7 ...
-
bioRxiv - Microbiology 2023Quote: ... these fragments were assembled along with the previously PCR-amplified vector pR6KTet-SacB using the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). The assembled constructs were then transformed by electroporation into E ...
-
bioRxiv - Microbiology 2024Quote: ... the PCR cocktail mix (25 µl) consisted of 12.5 µl OneTaq® Quick-Load® (2x Master mix; New England Biolabs), 1.5 µl each of forward (10 µM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting products were pre-amplified in a 100 μL reaction using 10 cycles with 4 μL pre-amp primers (10x Genomics PN 20002714) and 50 μL of NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S). Reactions were cleaned with 1.6X SPRI and eluted in 40 μL EB ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed in a 50 μl volume containing Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs). Quantitative analysis of the purified libraries was performed using Qubit 3.0 Fluorometer and Qubit® dsDNA HS Assay kit (InvitrogenTM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was then used for PCR with the OneTaq 2x Master mix with Standard Buffer (New England Biolabs, Ipswich, Massachusetts). Targets for differential editing of the mutant in p150 and p110 were ...
-
bioRxiv - Genomics 2023Quote: The purified cDNA was PCR amplified for 6 cycles to generate dsDNA with NEBNext Ultra II Q5 High-Fidelity 2X Master Mix (NEB, M0544) and 0.5 uM PCR primers with unique dual index using the following PCR cycles:
-
bioRxiv - Genomics 2023Quote: ... and the adaptor ligated cDNA was amplified with 12 cycles of PCR with NEBNext Primer Mix (96 Unique Dual Index UMI Adaptors RNA set1, (NEB #E7416). Equimolar amounts of the samples were then pooled and sequenced using NextSeq 500/550 70 base read lengths in paired-end mode.
-
bioRxiv - Molecular Biology 2023Quote: We first amplified a 77 bp long minimal TK promoter followed by the mCherry coding sequence by PCR and inserted the fragment into an NcoI-HF®-digested (NEB) pGemT-vector (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by polymerase chain reaction (PCR) using isopropanol-precipitated genomic DNA as template and OneTaq DNA polymerase (New England Biolabs, (NEB), #M0480 ...
-
bioRxiv - Neuroscience 2023Quote: ... Titration of viral particles was performed by quantitative PCR (qPCR) using serial dilutions of purified AAV concentrates and Luna Universal qPCR mix (NEB#M3003). Oligonucleotide primers for AAV titration purpose were forward woodchuck hepatitis virus post-transcriptional regulatory element (WPRE ...