Labshake search
Citations for New England Biolabs :
5401 - 5450 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... The IntS6 PCR product and pMK33-SBP C-terminal vector (Yang and Veraksa, 2017) were digested with XhoI and KpnI-HF (NEB R3142) at 37°C overnight and purified digests were ligated overnight at 16°C ...
-
bioRxiv - Physiology 2019Quote: ... The obtained 20-nt sequences were incorporated into a DNA oligonucleotide template containing a T7 promoter and a sgRNA scaffold by overlapping PCR using Phusion high fidelity DNA polymerase (New England Biolabs, M0530). The primer sequences for overlapping PCR were as previously described11 including the designed sgRNA sequences ...
-
bioRxiv - Microbiology 2019Quote: ... Typhimurium NCTC 12023 and the vector including the Tet-on system aph tetR PtetA present on p4392 occurred using oligonucleotides as listed in Table S 1 and purified by PCR purification (NEB Monarch). The PCR product encoding for sadBA and the PCR product from vector p4392 were assembled by Gibson assembly according to manufactureŕs protocol (NEB Monarch) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-ACGTACGCGGCCGCAAAATGAGGCTGCACCTGGCGGCGATCC-3’ and 5’-ACGTACTCTAGACTACTCGTGCCACTCGATCTTCTGGGCTTCAAATATGTCATTCA AACCGCCTCCAATTACAAAGGCCGTGATCCAGTCCAGAAACTTGGCC were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing a Drosophila gd cDNA as template ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Cell Biology 2019Quote: ... Homologous 15bp overhangs on the 3’ end of the inverse PCR primers were ligated following the NEB T4 Ligation protocol (New England Biolabs # M0202S) to introduce the 5AA sequence ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1 μl of the supernatant was used as the PCR template in a 20 μl-reaction with Q5 High-Fidelity DNA Polymerase (New England Biolabs, US). Lastly ...
-
bioRxiv - Biochemistry 2019Quote: ... Three replicates of each condition were subjected to fluorescent PCR with a FAM-labelled forward primer (below) and with Phusion polymerase (NEB #M0530S) for 32 cycles ...
-
bioRxiv - Genomics 2019Quote: ... The DNA (50-100 ng) was amplified using the Phusion Hi-Fi PCR master mix with HF buffer (New England Biolabs M0531) or the Q5 Hot Start HiFi PCR master mix (New England Biolabs E6625AA ...
-
bioRxiv - Immunology 2019Quote: ... The ITS2 region was amplified and Illumina adapters appended by PCR in 25 ul volume with Q5 High-Fidelity 2X master mix (NEB, # M0492L). PCR conditions were as follows ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and a PCR product of about 300 nucleotides from a coding sequence was than amplified by PCR using Q5® High-Fidelity DNA polymerase (New England Biolabs). The resulting PCR products were gel purified ...
-
bioRxiv - Biochemistry 2019Quote: ... site-directed mutagenesis was conducted using overlap extension PCR (Pavoor et al. 2009) using the Phusion DNA polymerase (New England Biolabs # M0530) (see Supp ...
-
bioRxiv - Genetics 2019Quote: ... 2 μl of genomic DNA was used as template in a 40 μL PCR reaction with LongAmp® Taq DNA Polymerase (NEB). The 415bp PCR fragment of white target was amplified with CGTTAGGGAGCCGATAAAGAGGTCATCC (w.sF ...
-
bioRxiv - Microbiology 2019Quote: ... Donor sequences which typically contain 500-bp upstream and 500-bp downstream of the editing sites were amplified by PCR and ligated into the linearized targeting plasmid (digested by XhoI (NEB, USA)) using the ClonExpress One Step Cloning Kit (Vazyme ...
-
bioRxiv - Cancer Biology 2019Quote: sgRNA barcode sequences were amplified by PCR using the extracted gDNA from either CRISPRi or CRISPRa screens as template and Phusion (NEB M0530) as polymerase ...
-
bioRxiv - Developmental Biology 2019Quote: ... Each potential sgRNA off target site listed in Table S2 (off-target score provided by Benchling) was screened by High-Fidelity PCR (Q5 NEB, M0491L) with primers listed in Table S5 and PCR products were sequenced using Eurofins Genomics tube DNA sequencing services ...
-
bioRxiv - Microbiology 2019Quote: ... Eluted DNA was transferred to a new tube and PCR enrichment of the adaptor ligated DNA was performed using NEBNext Multiplex Oligos for Illumina (Set 1, NEB #E7335). The PCR reaction mix was assembled according to manufacturers’ recommendations and placed in a thermal cycler set to the recommended conditions ...
-
bioRxiv - Immunology 2020Quote: ... Target DNA was amplified from a cDNA template or existing plasmids using primers and PCR conditions shown in Tables S2-S4 using Q5 High-Fidelity 2X Master Mix (New England Biolabs # M0494L). Primers were ordered with 5’ base extensions that overlapped expression vectors on either side of the restriction sites ...
-
bioRxiv - Genetics 2019Quote: ... PCR was performed using the designed primers (Table S4) on converted cDNA using NEB taq polymerase (New England Biolabs, Ipswich, MA), and run on a 2% agarose gel with ethidium bromide to test for specificity.
-
bioRxiv - Genetics 2019Quote: ... PCR amplification of short DNA fragments (<3000 bp in length) was conducted using OneTaq® DNA polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genetics 2019Quote: ... PCR amplification of short DNA fragments (<3000 bp in length) was conducted using OneTaq® DNA polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Systems Biology 2019Quote: ... REV: TTACTTCGCTGTCATCATTTGTACAAACTCTTCGTAG) pEntry_GCaMP5G was linearized with PCR reaction using standard Phusion® Hot Start Flex 2X Master Mix (NEB Cat# M0536L) protocol (FOR ...
-
bioRxiv - Genetics 2019Quote: ... Homology arms for the SPO11 BAC were introduced by PCR with Phusion polymerase (New England Biolabs GmbH, Frankfurt am Main, Germany). The 1.3 kbp PCR product was purified with a Gel Extraction Kit (QIAGEN ...
-
bioRxiv - Genetics 2021Quote: ... At first, PCR were run with primers (oJZ_241/242, see S3 File) with LongAmp polymerase (New England Biolabs; Ipswich, MA, USA), purified and sequenced (Sanger sequencing?) ...
-
bioRxiv - Genomics 2021Quote: ... standard Gibson Cloning for S1 or S2 inserts plus PCR-amplified/DpnI-digested backbone was performed using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) at 3:1 insert to vector ratio ...
-
bioRxiv - Genetics 2019Quote: ... Purified DNA was used to construct high-throughput sequencing libraries using NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs M0541). DNA libraries were processed on a Illumina NextSeq machine for paired-end 41-nt sequencing ...
-
bioRxiv - Genomics 2021Quote: ... Amplification reactions from this cDNA were performed with the 5’ PCR primer and a reverse primer corresponding to the target sequence using LongAmp Taq polymerase (NEB M0287). The PCR products were sequenced and the junction between the ligated oligo revealed the start sites.
-
bioRxiv - Genomics 2021Quote: ... 5.25 mg of genomic DNA (gDNA) was used as template across 525 x 100 µL PCR reactions using Q5 2X Master Mix (NEB, M0492L). For the distal sub-library screens ...
-
bioRxiv - Genomics 2020Quote: ... were dispensed at 35nL in wells that contained single cells followed by two dispenses of 50nL (100nL total) 2x NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L). The chip was sealed and spun down at 2250xg for 3 mins after each dispense ...
-
bioRxiv - Plant Biology 2020Quote: ... the sgRNA backbone and either a U6-29 promoter or a tRNA buffer were produced by four-primer PCR (described in Xing & al., 2014) with a proofreading enzyme (Q5 polymerase, New England Biolabs, M0491). Briefly ...
-
bioRxiv - Bioengineering 2021Quote: ... dsDNA fragments were inserted into PCR-amplified (primers 17-18 in Table S3) and purified pRSET vector fragment by Gibson Assembly (NEB, USA) to add sequence parts necessary for cDNA display generation to the DNA library ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL P7 primer (10 μM) (5ʹ-CAAGCAGAAGACGGCATACGAG AT[i7] GTCTCGTGGGCTCGG-3ʹ; IDT) and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541). Amplification was performed using the following program ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was carried out using NEB Luna Universal Probe One-Step Reaction Mix and Enzyme Mix (New England Biolabs, Herts, UK), primers and probe at 500 nM and 127.5 nM ...
-
bioRxiv - Neuroscience 2020Quote: ... fragments were generated by PCR from the indicated template with the indicated primers (Data File 1) and assembled using NEBuilder HiFi DNA Assembly (NEB E5520S). Plasmids were transformed into NEB competent cells (NEB C2987I) ...
-
bioRxiv - Neuroscience 2020Quote: ... we generated DNA template for transcription of a new batch sgRNA (separate from that used for validation) by annealing two partially overlapping PCR primers (IDT, PAGE purified) and extending with NEBNext High-Fidelity polymerase (NEB, M0541S). We then transcribed each sgRNA in vitro using the HiScribe T7 Kit (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... Successful generation of ΔpufX and ΔpufY strains was confirmed using PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, UK) and DNA sequencing (Eurofins).
-
bioRxiv - Biochemistry 2021Quote: PCR of the tagged DNA was performed in 25 μl reactions in 200 μl thin-walled PCR tubes containing 1X Q5® Buffer (NEB), 1X Q5® GC Enhancer (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...
-
bioRxiv - Cell Biology 2021Quote: The recovery probe was prepared as follows: A standard 100 µl PCR reaction was prepared containing 10 ng of bacteriophage λ DNA (NEB), 5 units of Taq polymerase (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... CK1γ3 kinase dead mutants were generated using PCR mutagenesis and cloned into pDONR223 digested with BsrGI using Gibson Assembly Master Mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragments containing 21 base pair overhangs homologous to the vector backbone were generated by PCR using Phusion High-Fidelity DNA polymerase (NEB, M0530), purified ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 ng of gDNA were used to set up a PCR using Phusion® High-Fidelity DNA Polymerase (New England BioLabs). The PCR product was separated in a 1% agarose gel by electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Biochemistry 2020Quote: ... Novel mutants of Ecm2 were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs; Ipswich, MA). All plasmids were confirmed by sequencing.
-
bioRxiv - Microbiology 2020Quote: ... a colony of each isolate was resuspended in 50 µL of sterile water then 1 µL of resuspended bacteria was used in a PCR reaction using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) with forward (16s-8F ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Systems Biology 2021Quote: ... The final enrichment PCR used primers MO588 and MO589 (Supplementary file 6) for 20 cycles at an annealing temperature of 66C (NEB Phusion), followed by purification with the Monarch PCR kit ...
-
bioRxiv - Plant Biology 2021Quote: The coding sequence of NKS1 with or without stop codon was amplified by PCR using gene specific primers (Table S7) from cDNA using Phusion High-Fidelity DNA polymerase (F530S, NEW ENGLAND BioLabs, Inc) or PrimeSTAR HS DNA polymerase (R010A ...