Labshake search
Citations for New England Biolabs :
4951 - 5000 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The purified fragments were then 5’ phosphorylated in a 50 μL reaction containing 10 U of T4 polynucleotide kinase (NEB) and cleaned up through the Monarch PCR & DNA Cleanup spin columns (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: MBP-tagged RH domain was isolated via passing cleared lysate over a gravity amylose resin column containing 5 mL of settled resin (NEB). Column was washed with 150 mL of buffer before eluting protein with wash buffer supplemented with 20 mM maltose ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Bioengineering 2023Quote: ... the 5’ end of each oligonucleotide to be ligated was phosphorylated using T4 Polynucleotide Kinase (T4PNK) (New England Biolabs: M0201) at 1 U/25 pmol ends incubated at 37 °C for 90 minutes followed by a 65 °C heat shock for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... and the samples were resuspended in cold Nuclei suspension buffer (5 mL PBS, 50 μL NEB BSA (10 mg/mL), and 25 μL RNase inhibitor (40 U/μL)) ...
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis of csn-5(D152N) was performed using a Q5 site-directed mutagenesis kit per manufacturer instructions (New England BioLabs). For transgenic lines used in PLA ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA from the indicated cell lines was prepared in agarose plugs by resuspending 5 x 106 cells/ml in 0.8% agarose and digested overnight with Fse1 (NEB; R0588L) at 37 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-ends of the DNA linkers and the rRNA were deadenylated by 5’-deadenylase and the excess linkers were degraded by DNA-specific RecJf exonuclease (NEB). rRNA was reverse transcribed using a linker-specific primer and Protoscript II RT (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Cancer Biology 2024Quote: ... Base editing sgRNA directed against the SF3B1 K700 locus was designed using BE-Designer28 and cloned into pLKO.5 Puro-2A-GFP between BsmBI (New England Biolabs) cut sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... the hU6-pegRNA2-polyT cassette was amplified from the pU6-pegRNA-gg-acceptor backbone and ligated into ngRNA1 pLKO.5 Puro-2A-RFP between EcoRI and XhoI (New England Biolabs) to create pLKO.5-K700E-ng1+pg2-Puro-2A-RFP ...
-
bioRxiv - Cell Biology 2024Quote: ... Synthetic oligonucleotides encoding 3xFLAG were then ligated to the 5’ position of APEX2 sequence using NEBuilder HiFi DNA assembly kit (New England Biolabs) to form the final vector pcDNA5/FRT/TO/3xFLAG-APEX2.
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligos (20 pmoles) were labeled at their 5’ ends using gamma-32P-rATP (3000 Ci/mmole) and polynucleotide kinase (New England Biolabs), and purified on 7M urea ...
-
bioRxiv - Molecular Biology 2024Quote: ... AlkB D135S and AlkB D135S/L118V were mixed and incubated with 1 pmol of a synthetic RNA oligonucleotide carrying m1A or m1G at the 5’-end (m1AUGCACUUGGACGAACCAGAGUGUAGCUUAA, IBA Sciences; m1GGCGCAGCGGAAGCGUGCUGGGCCCA, kindly provided by R. Micura) previously 32P-labelled with T4 PNK (NEB), and 500 ng total RNA extracted from HAP1 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... the tissue was incubated in 5 mL of a clearing solution comprising Clearing Premix (Vizgen, PN 20300003) and 50 μL Proteinase K (New England BioLabs) at 37°C in a humidified benchtop incubator until the tissue was cleared.
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... 120 µL 10x T4 DNA ligase buffer and 5 µL of 400 U/µL T4 DNA ligase (New England Biolabs) was added ...
-
bioRxiv - Immunology 2024Quote: ... The PCR amplicon was purified by sequential gel extraction (1.5% agarose gel prepared in 0.5x TAE) and affinity column chromatography (Monarch® PCR & DNA Cleanup Kit, New England Biolabs). For IVT synthesis ...
-
Recurrent loss of crossover interference punctuates the recombination landscape across yeast speciesbioRxiv - Genomics 2024Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Microbiology 2024Quote: ... according to manufacturer’s instructions using 100 nM RNA-specific reverse transcription primer followed by RNase H digest with 5 µL RNase H (NEB) at 37 °C for 20 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each of the synthesized DNA fragments was amplified by PCR and inserted at the 5’ of the GFP gene in the pPha-NR vector (NovoPro Bioscience) using NEBuilder HiFi DNA Assembly (New England BioLabs). Five μg of the pPha-NR constructs were introduced into P ...
-
bioRxiv - Physiology 2023Quote: ... purified and analyzed to quantify 5-methylcytosine levels by applying the DNA Purification Kit (T3010S, Monarch, New England Biolabs, USA) and the 5mC Assay Kit (lot no ...
-
bioRxiv - Biochemistry 2023Quote: ... the lysate was clarified by centrifugation at 5°C at 18 500 rpm for 30min and loaded onto gravity flow amylose resin (NEB) previously equilibrated with buffer WB1_1 (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation and dA-tailing by NEBNext FFPE DNA Repair and NEBNext Ultra II End prep modules (New England Biolabs) and purified with AMPure XP (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 5’ adapter (10 µM) was added and incubated for 5 min at 65°C before addition of T4 ligase buffer (NEB), final 25% PEG8000 and T4 RNA ligase 1 (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and material was amplified for 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs catalog # M0541L). After evaluation by real-time PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of the library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 µl of each PCR product was digested with either 0.5 µl XceI/NspI (for Trim28+/D9; Themo Scientific, FD1474) or 0.5 µl MslI (for Tp53R270H/+; New England BioLabs, R0571L) in a final reaction volume of 30 µl ...
-
bioRxiv - Genomics 2024Quote: ... 1 μg of each sublibrary plasmid was digested at 37°C for 5 hours with NheI-HF and SacI-HF (New England Biolabs), incubated with rSAP for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was then transferred to a fresh low-bind tube containing pre-washed 5 µl amylose magnetic beads (NEB) and rotated for 45 min at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: ... Radioactive probe was prepared using 40 pmol of primer 59 and 5’-labelled with 10 U of T4 Polynucleotide Kinase (New England Biolabs) and [γ32P]ATP (150 μCi) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and containing the sequence DuxblExon 5-iRFP702-Duxbl3’UTR after amplifying the corresponding sequences by PCR followed by Gibson assembly (New England Biolabs) (Supplementary Table 8) ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng of high integrity total RNA (RIN >5) was depleted of rRNA using the NEBNext rRNA Depletion Kit (New England BioLabs). NEXTflex Rapid Directional RNA-Seq Kit (Bio-Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... the beads were resuspended in TEV buffer (final volume 5 mL) with 100 μL TEV protease (New England BioLabs, #P8112S) and incubated at 4°C on a roller overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA (5-10 μg) derived from transfected ESC was digested by high concentrated HindIII-HF or high concentrated BamHI-HF (NEB). In all Southern blot analyses ...
-
bioRxiv - Immunology 2022Quote: ... cells were brought to 5×105 cells/ml and incubated with transposition reaction mix (NEBNext High-Fidelity 2X PCR master mix, NEB) for 30 min ...
-
bioRxiv - Genetics 2022Quote: ... 5 ng of the synthesized oligo pool were carried out using the Phusion High Fidelity DNA Polymerase (New England Biolabs), with a total of 15 cycles and an annealing temperature of 56 °C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5′ RNA linkers with four terminal random nucleotides were then ligated to the small RNAs using T4 RNA ligase (NEB) followed by another round of PAGE purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... The products were analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel against a 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) and quantitated with a phosphorimager (Typhoon FLA 9500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The thyA gene region was amplified from the genomic DNA (5 ng) with Phusion High-Fidelity PCR Master Mix (New England Biolabs) using 200 nM of thyA forward and reverse primers that give amplicons of 750 bp ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was fragmented at 95°C for 5 min by using a Next Magnesium RNA Fragmentation Module (New England Biolabs), and cleaned up by using a MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel with 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) run in a parallel lane ...
-
bioRxiv - Molecular Biology 2023Quote: ... each 10 μL of double stranded PCR products were treated with 5 units Lambda exonuclease enzyme (New England Biolabs, NEB) at 37 °C for 45 min which is followed by 10 min at 75 °C for enzyme inactivation.
-
bioRxiv - Molecular Biology 2023Quote: ... each 10 μL of double stranded PCR products were treated with 5 units Lambda exonuclease enzyme (New England Biolabs, NEB) at 37 °C for 45 min which is followed by 10 min at 75 °C for enzyme inactivation.
-
bioRxiv - Molecular Biology 2023Quote: Randomly biotinylated DNA templates for TECprobe-ML experiments were PCR amplified from a 5’ biotinylated linear DNA template using Vent (exo-) DNA polymerase (New England Biolabs) and primers HP4_5bio.R and PRA1_NoMod.F (for ZTP and fluoride templates ...