Labshake search
Citations for New England Biolabs :
5101 - 5150 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Double-stranded oligonucleotides corresponding to synthetic enhancers with gibson arms were synthesized by IDT (GeneBlock) and assembled into targeting vector using 5 μl of NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S), 36 ng of linearized vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Genomics 2022Quote: ... 1500 calcein-stained cells in 5 μL of were added to 35 μL of barcoded hydrogel templates with 29 U/mL Proteinase K (NEB #P8107S) and 70 mM DTT (Sigma #D9779 ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Bioengineering 2024Quote: ... The splitGFP plasmid was amplified using primers 53 and 54 to install 3’ stop codon and primers 55 and 56 to install the 5’ stop codon using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was then returned to ice for 5 minutes before 180 μL of NEB® 10-beta/Stable Outgrowth Medium (B9035, NEB) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Systems Biology 2024Quote: ... The resulting full-length cDNA was gel-purified and ligated to the 5′ adaptor OWG920 with High Concentration T4 RNA Ligase (NEB M0437M) overnight on a shaking thermomixer ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µl of 100 µM barcode-linked oligo-dT primer was added to each well with 5 µl of 5x ProtoScript RT buffer (New England Biolabs M0368). The plate was incubated at 94°C for 2 min and immediately cooled on ice for at least 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transposed DNA was then purified on Diapure columns (Diagenode, Transposed purified DNA was then pre-amplified for 5 PCR Cycles using NEBNext High-Fidelity PCR MasterMix (NEB, M0541) and Illumina indexing primers ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were constructed using the NEBNext Ultra II directional RNA library preparation kit for Illumina according to the protocol for purified mRNA or ribosome-depleted RNA and with a 5-min RNA fragmentation step (NEB E7760). Library PCRs were supplemented with 2× SYBR dye (Sigma S9430 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 μL of PCR product was added to a 10 μL reaction containing 0.2 μL DraI (New England BioLabs, MA, USA) and 1 μL rCutSmart™ Buffer (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... Prior to library preparation a UDG-treatment was performed using 16.25ul of purified DNA and 5 μl (1U/1uL) USER enzyme (New England BioLabs®, Inc.) and an incubation of 3 hours at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... The regulatory sequences of Crbn were PCR amplified from genomic DNA (primers in Supp Table 5) and cloned into a pCESA vector upstream of H2BGFP coding sequences using the restriction enzymes AscI and NotI (NEB England). Mutations into the Snail binding motif of the Crbn regulatory sequences were obtained by recombination using NEBuilder (NEB England ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 pmol dephosphorylated RNA was 5’ phosphorylated with 32P from γ-32P ATP (Hartmann Analytic) with T4 PNK (New England Biolabs) in 1x PNK buffer in a 20 μl reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Toe-printing reactions were carried out in 5-µl aliquots containing a PURExpress transcription-translation coupled system (New England Biolabs, USA) to which the test template was added (16) ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of the enzyme was used in the 50 μl-reaction containing 5 μl of rCutSmart Buffer (10X, NEB # B6004S) for 30 min-incubation at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... ds-DNA was constructed from two oligos that are annealed and 5’ overhangs filled in using Klenow polymerase according the manufacture’s specifications (NEB cat. M0210L). All yeast transformation were carried out using the lithiumacetate method ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by treatment with DNase I.5 The samples were then purified with the Monarch® RNA Cleanup Kit (New England Biolabs).
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was carried out by addition of 5 µL 10 µM Nextera index mix(Vazyme, #TD203) and 25 µL Q5 High-Fidelity 2X master mix (NEB, #M0492S) to the 20 µL sample ...
-
bioRxiv - Biochemistry 2023Quote: ... The total RNA was treated by DNase I (5 U per 100 μg total RNA) and mRNAs were enriched by NEBNext Poly(A) mRNA magnetic isolation module (NEB E7490L). 8-10 μg of mRNA from each sample was fragmented to the size of ~120-nt by Ambion Fragmentation reagent (Thermo Scientific AM8740 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and sequencing libraries were prepared from 5 ng of the purified amplicon using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, E7370L) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... Samples were then incubated in 30°C water bath for 5 hours with 50 μL of RCA mixture that contained 250 μM dNTP (New England Biolabs, N0447L), 1 mM extra-supplemented DTT ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... Multiplex-polymerase chain reaction (PCR) was performed in two separate reaction mixes prepared by combining 5 μl of 5X Q5 Reaction Buffer (NEB, M0493S), 0.5 μl of 10 mM dNTPs (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... was modified with a guide RNA (GTCGGACGCGAAACTCGCTT) to target the 5’ region of the ROP33 gene (sgROP33) using Q5 mutagenesis (New England Biolabs, MA). Then a CRISPR/Cas9 replacement construct was created using Gibson assembly (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ termini of all ten DNA fragments (F1-F9 and the linker) were phosphorylated by using T4 PNK (NEB; #M0201), and the equimolar amounts (0.05 pmol each ...
-
bioRxiv - Molecular Biology 2024Quote: ... The adaptor-ligated DNA on the magnetic beads was amplified by 5-8 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544) and NEBNext Multiplex Oligos for Illumina (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... we performed an A-tailing of the PCR products of the YTS191-light chain cDNA by adding 5 µl of 10X ThermoPol Buffer (NEB, B9004), 10 µl of 10 mM ATP ...
-
bioRxiv - Neuroscience 2024Quote: ... long amplification of the CHRFAM7A intron (exon A to exon 5) was carried out with the LongAmp® Taq DNA Polymerase Kit (ref. E5200S, New England Biolabs), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Precipitated RNAs were resuspended in Milli-Q water and labeled at the 5’-end with [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs). Excess [γ-32P]-ATP was removed by G-25 MicroSpin column (Cytiva ...
-
bioRxiv - Biochemistry 2024Quote: 27.4 μg of total RNA was fragmented into ∼150-200 nt fragments at 94 °C for 5 minutes using the magnesium RNA fragmentation buffer (NEB, E6186AVIAL), followed by purification with OCC ...
-
bioRxiv - Bioengineering 2024Quote: Samples were resuspended in 5 µl 1X NEBNext Cell Lysis Buffer of the NEBNext Single Cell/Low Input RNA Library Prep Kit (NEB, E6420). After 5 min incubation at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified DNA fragments were cloned into pcDNA3.1 vector and transformed into 5-alpha competent cells (#C2987H, New England Biolabs, Ipswich, MA) and 10 colonies were picked for each cell line ...
-
bioRxiv - Biophysics 2024Quote: ... A 691 bp biotinylated DNA handle with a 29 nt 5′ overhang was amplified by Q5 DNA polymerase (NEB, Cat# M0491S) using a 5′ biotinylated forward primer and a reverse primer containing an abasic site 43 ...
-
bioRxiv - Biochemistry 2024Quote: ... corresponding to both strands of the tRNA His promoter from positions −45 to +76 or DNA mutants were end labeled using [γ-32P] adenosine 5′-triphosphate (ATP) and T4 polynucleotide kinase (New England Biolabs) and purified on a 10% acryl/bisacrylamide ...
-
bioRxiv - Synthetic Biology 2024Quote: ... to further phosphoporylate the amplified dsDNA before the addition of 5 µL of Quick-Ligase enzyme (NEBNext Quick Ligation Module, NEB, UK) and the solution was further incubated at 20 °C for 30 min.
-
bioRxiv - Cancer Biology 2024Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Genomics 2023Quote: ... and incubated at 37°C for 1 hour with RNase A/T1 (Thermo, 1/20 volume) and RNase H (NEB, 1/50 volume). The DNA was then purified again.
-
bioRxiv - Neuroscience 2021Quote: ... 1 μL cDNA was amplified using 1 μL Phusion High-Fidelity DNA Polymerase (NEB) in HF Phusion buffer with 10 μM primers ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL Bacillus stearothermophilus (Bst) DNA polymerase (8 U μl-1) (New England Biolabs), 2 μL DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... amplicons were visualized on ~1% agarose gels with 1 kb plus DNA ladder (NEB) and SYBR Gold (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μl of High Concentration T4 RNA Ligase 1 (New England BioLabs, M0437)] at 23°C for 5 h ...
-
bioRxiv - Genetics 2023Quote: ... containing 1× Exonuclease I Buffer and 1 U/µL Exonuclease I (NEB, cat # B0293S), and incubated at 37 °C for 45 min ...
-
bioRxiv - Microbiology 2023Quote: ... lysates (1 mg) were incubated with MNase (10 units/1 mg lysate; NEB #M0247S) at 37°C for 60 min ...
-
bioRxiv - Microbiology 2024Quote: ... the product was incubated with 1 μL of dTTP (1 mM, NEB Catalog # N)443S) ...
-
bioRxiv - Microbiology 2024Quote: ... the product was incubated with 1 μl of dTTP (1 mM, NEB Catalog # N443S), 1 μL of Tdt buffer ...