Labshake search
Citations for New England Biolabs :
4851 - 4900 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 1:50 (NEB, 14001), (5 ...
-
bioRxiv - Genetics 2020Quote: ... 1:100 (NEB, 51255), (4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ligase 1 (NEB) sequentially ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM ATP (NEB), 1×T4 DNA Ligase Buffer and 800 U T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 1× Buffer 2.1 (NEB), 2 µg BSA and 3 units of T4 DNA polymerase (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... coli Topoisomerase 1 (NEB), 0.1 mg/ml BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl MlyI (NEB). The digest was incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM NAD+ (NEB) and water to a volume of 20 μl ...
-
bioRxiv - Genomics 2022Quote: ... 1 mM dNTPs (NEB), 1 U/μL RNase Inhibitor (NxGen ...
-
bioRxiv - Molecular Biology 2023Quote: ... pyogenes (1 μl, NEB), and 0.2 µl phenol red were mixed in an Eppendorf tube (total volume 2.2 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... after DNase 1 (NEB) treatment.
-
bioRxiv - Microbiology 2024Quote: ... 1 mM NAD+ (NEB), 4 µg of DNA or RNA oligo ...
-
bioRxiv - Genomics 2024Quote: ... 1% BSA (NEB, B9000S), and 1U/ml Protector RNase Inhibitor (between 100-200 μl depending on pellet volume) ...
-
bioRxiv - Genomics 2023Quote: ... 1 mM ATP (NEB), 4 mM DTT (Promega) ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl RNaseOut (NEB), 2 μl of 100 μM TSO ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µl DpnI (NEB) was added to the PCR mix ...
-
bioRxiv - Genomics 2023Quote: ... and 1× Thermopol (NEB) at 72°C for 60 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µl ExoI (NEB) and incubated for 1 h at 37°C followed by heat inactivation of 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Apyrase (1-unit, NEB) was then added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Apyrase (1 unit, NEB) was added for an additional 1.5 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... apyrase (1 unit NEB) was added for an additional 1.5 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... with GlycoBuffer 1 (NEB) was added.
-
bioRxiv - Genomics 2024Quote: ... 1 μL NAD+ (NEB), 1 μL dNTP mix (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA integrity was assessed by performing 1% TBE agarose gel electrophoresis with samples that had been boiled for 95°C for 5 min in RNA loading dye (New England Biolabs). Genomic DNA was eliminated by incubating 2 μg of RNA with 2 U of RQ1 RNase-free DNase I (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Genetics 2021Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Molecular Biology 2022Quote: The L3 DNA linker at 0.5 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using 5 U/μl of RNA Ligase Truncated K227Q (NEB) in the presence of 15% PEG8000 and 1 U/μl RNasin (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... The total RNA recovered was split into samples of 5 μg each and enriched in poly(A) transcripts using NEBNext Poly(A) mRNA magnetic isolation module (NEB) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 400-800 fmol of nucleosomes purified from sucrose gradients was digested with a 5-25U titration of ExoIII enzyme (New England Biolabs) for 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ChIP sequencing libraries were built from immunoprecipitated DNA by first end repairing the DNA with 5 µL T4 DNA polymerase (NEB), 5 µL T4 PNK (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... CHART-enriched DNA was eluted twice in 200 μL elution buffer supplemented with 5 U/μL RNase H (New England BioLabs) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... aqueous phase containing the barcoded cDNA (~50 μL) was combined with 50 μL digestion mix containing 5 μL ExoI enzyme (NEB), 5 μL HinFI enzyme (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: The splint ligation reaction was performed by preparing a 5 µl mastermix that consisted of 0.5 µL Hifi Taq Ligase (NEB #M0647S), 0.5 µl 10x Taq ligase buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was PCR-amplified for 25 cycles with 5’-Cy3-labelled reverse primers (IDT) and unlabeled forward primers using either Taq polymerase or Phusion high-fidelity polymerase (NEB). PCR products were separated on 40cm tall 6% polyacrylamide denaturing gels and then visualized using a Molecular Dynamics Typhoon Scanner ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was eluted from the beads via phenol extraction or heating in water at 80oC for 5 min and ssDNA adapter [Phos]CCACGCGTGCCCTATAGTCGC[Ami] was ligated using T4 RNA ligase (NEB). Libraries were amplified and barcoded via nested and tagged PCR following the original protocol (47 ...
-
bioRxiv - Genomics 2020Quote: PCR3 was performed by subtracting 2-3 cycles from the Ct and using 2.5 uL of a mix of distinct indexed primers from the NEBNext Dual Index Kit for Illumina (New England Biolabs) using 22.5 uL PCR2 product in a 50 uL reaction volume (Q5 UltraII mastermix with EvaGreen (Biotium) ...
-
bioRxiv - Genomics 2020Quote: ... was transcribed from a sgRNA-coding PCR product with a 5′ T7 promoter sequence using HiScibe T7 Quick High yield RNA Synthesis kit (NEB). The transcription was performed at 37 °C overnight and then purified by phenol ...
-
bioRxiv - Genetics 2020Quote: ... ChIP enrichment was determined by RT-qPCR (Supplementary Table 5) prior to addition of sequencing adaptors using NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs). ATAC-seq was performed as previously described76 ...
-
bioRxiv - Genetics 2020Quote: ... was incubated with or without 5 µM nucleotides DNA substrates (cssDNA, Phi X174; or ldsDNA, Phi 174 RF I; both from NEB) with 1 mM ATP in ATPase buffer (25 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Microbiology 2021Quote: ... 15 μL of PCR product were mixed with 5 μL of a 5X Exo-SAP solution (15% Shrimp Alkaline Phosphatase – 1000U/ ml – NEB, 10% Exonuclease I – 20000 U/ ml – NEB ...
-
bioRxiv - Systems Biology 2020Quote: ... followed by the addition of a single dA overhang and ligation of the first adaptor (5’-phosphorylated) using dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) ...
-
bioRxiv - Biochemistry 2020Quote: ... The insert and vector DNA were combined in a 3:1 insert:vector molar ratio in a volume of 5 μL and added 15 μL of Gibson Assembly Master Mix (New England BioLabs), consisting of T5 Exonuclease ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: ... Transcription reactions were set up with RNA NTPs (5 mM each ATP, CTP, UTP, 9 mM GTP) (NEB, Ipswitch, MA), 0.004 U/µL Thermostable Inorganic Pyrophosphatase (NEB ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... followed by the addition of a single dA overhang and ligation of the first adaptor (5’-phosphorylated) using dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... The three PCR products were assembled as one large fragment (5’ cynX - insert - lacA3’) by Gibson Assembly (New England Biolabs). The assembled DNA was transformed into electrocompetent WT E ...
-
bioRxiv - Microbiology 2021Quote: ... was dephosphorylated and 5’ end labeled with P32 as follows: 25 pmol of RNA was dephosphorylated using 50U of Antarctic Phosphatase (NEB) according to the manufacturer’s protocol ...
-
Lessons from the meiotic recombination landscape of the ZMM deficient budding yeast Lachancea waltiibioRxiv - Genetics 2021Quote: ... DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Microbiology 2020Quote: ... followed by the addition of a single dA overhang and ligation of the first adaptor (5’-phosphorylated) using a dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... for 5 minutes at 37°C for TIR-FM imaging or 1μM permeable SNAP-Cell 647-SiR (New England Biolabs, #S9102S) for 15 minutes followed by a 15 minute wash in cell culture media for confocal imaging ...