Labshake search
Citations for Illumina :
4051 - 4100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and all CUT&RUN libraries were sequenced on a NovaSeq6000 (Illumina) platform at Novogene Co. ...
-
bioRxiv - Developmental Biology 2023Quote: ... using the NovaSeq 6000 S1 Reagent Kit (100 Cycles) (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... scRNA-seq libraries were pooled at equimolar concentration and sequenced to saturation (median 6 reads/UMI) on an Illumina NextSeq 500 sequencer and using high-output 75 cycles v2.5 kits (Illumina), obtaining 483M reads in total ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we analyzed four strains present in both the global dataset (Illumina reads) and the chromosome-level assembly dataset (PacBio reads ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We followed the TruSeq Nano DNA library prep standard protocol to generate libraries with a 350 base pair insert size for whole-genome paired-end sequencing (Illumina, San Diego, USA). We validated the fragment length distribution of the libraries with a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2023Quote: Short (Illumina) and long read (PacBio ...
-
bioRxiv - Developmental Biology 2023Quote: ... Clustering was carried out on a cBot and sequencing was performed on a HiSeq 2500 (Illumina, San Diego, CA, USA) using the paired-end 2×125 nt protocol on two lanes of a flow cell (SRA ...
-
bioRxiv - Cell Biology 2023Quote: ... and the library preparations were sequenced on an Illumina Novaseq platform (Illumina, San Diego, USA) to generate 150 bp paired-end reads ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was used for library preparation with NEBNext Ultra-low input II Directional RNA Library Prep Kit (Illumina) and sequenced on an Illumina HiSeq with 2×150 bp sequencing configuration (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... and sequenced on an Illumina HiSeq with 2×150 bp sequencing configuration (Illumina).
-
bioRxiv - Cell Biology 2023Quote: Library preparation for ATAC-Seq was performed on 1000-2000 cells with Nextera DNA Sample Preparation kit (Illumina), according to previously reported protocol89 ...
-
bioRxiv - Cell Biology 2023Quote: ... and sequenced using a 2500 Illumina with 125-bp paired-end reads (Illumina, San Diego, CA, USA). Sequence reads were aligned to GRCh38 and annotated using CompStor NOVOS and CompStor Insight (OmniTier ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were sequenced on an NextSeq 550 platform (Illumina, 75 cycles High Output Kit v2.0) and 75-bp paired-end reads were generated ...
-
bioRxiv - Developmental Biology 2023Quote: 6hpf and 12hpf H2A.Z and Anp32e genomic localization data were collected using Epicypher CUT&Tag protocol and library generation followed by Illumina paired-end sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared from 100 to 400 pg of cDNA using Nextera XT Kit (Illumina), as per the manufacturer’s instructions but with one-fifth volumes for each sample ...
-
bioRxiv - Developmental Biology 2023Quote: Indexed Illumina libraries were prepared using Nextera XT kits (Illumina) from cDNAs generated with SMARTer Ultra low input RNA kit (Takara Bio ...
-
bioRxiv - Genetics 2023Quote: ... using MiSeq Reagent Cartridge v2 300 cycles (Illumina, #15033624) and MiSeq Reagent Nano Kit v2 (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA-Seq libraries were generated from 150-300 ng of total RNA using TruSeq Stranded Total RNA LT Sample Prep Kit with Ribo-Zero Gold (Illumina, San Diego, CA), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 8 µL of 100 pM pooled libraries were loaded into lanes of a HiSeq 4000 (Illumina). At least 30M reads per library were generated ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was processed by ribosomal RNA depletion using the Ribo-Zero rRNA Removal Kit (Illumina) and sequencing library generated using the TruSeq RNA Library Prep Kit (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... and sequencing library generated using the TruSeq RNA Library Prep Kit (Illumina) with omission of PolyA selection ...
-
Pathogenic CD8 T cell responses are driven by neutrophil-mediated hypoxia in cutaneous leishmaniasisbioRxiv - Immunology 2023Quote: ... Ribo-Zero Gold rRNA depletion (Illumina, San Diego, CA, USA) removed ribosomal content ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.0.4 (Illumina, Eindhoven, The Netherlands) project using the hg38 reference genome ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µl 100 µM barcoded CRISPR KO primer (oMCB1440, aatgatacggcgaccaccgagatctacacGATCGGAAGAGCACAC GTCTGAACTCCAGTCAC NNNNNN CGACTCGGTGCCACTTTTTC, where NNNNNN is an Illumina TruSeq index), and 69.4 µl nuclease-free water were added to the 5 µl PCR1 reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594, Illumina). Libraries were sequenced on Illumina NextSeq 500 as paired-end 42-nt reads and the reads were subsequently mapped to the human hg38 reference genome using STAR algorithm version 2.6.0a ...
-
bioRxiv - Cell Biology 2023Quote: ... and sequenced on NovaSeq 6000 (Illumina). The FASTQ files were generated using FastQC (v0.11.7 ...
-
bioRxiv - Immunology 2023Quote: ... Ribo-Zero Gold rRNA depletion (Illumina, Cat # MRZG12324) was used to remove ribosomal content ...
-
bioRxiv - Immunology 2023Quote: ... and sequenced on DNBSEQ (MGI) and NovaSeq (Illumina) sequencers ...
-
bioRxiv - Genomics 2023Quote: ... resuspended in 50 μl of transposition reaction mix (25 μl of Tagmentation DNA buffer, 2.5 μl Tagment DNA enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits ...
-
bioRxiv - Genomics 2023Quote: ... Genomic libraries were prepared using Illumina’sNextera XT DNA Library Prep kit (Illumina, San Diego, California, USA). The pooled libraries were sequenced on the IlluminaMiSeqplatform with a V3-300 reagent cartridge (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... and MiSeq low-depth sequencing (Illumina) to determine the approximate number of cells and estimate quality of the dataset ...
-
bioRxiv - Genetics 2023Quote: ... All samples were genotyped for ∼1.6 million SNPs on the MEGA array (Illumina, Miami, USA).
-
bioRxiv - Genetics 2023Quote: ... DNA extracts from the SAC individuals were genotyped for ∼1.6 million SNPs on the Illumina Multi-ethnic genotyping array (MEGA) (Illumina, Miami, USA).
-
bioRxiv - Genomics 2023Quote: ... Three RNA extractions passing QC (RIN > 9) were pooled in equimolar concentrations and a single transcriptomic library was constructed using Truseq mRNA kit (Illumina) and sequenced on a Illumina Novaseq 6000 sequencer (200M reads ...
-
bioRxiv - Genomics 2023Quote: ... Illumina Novaseq short-read sequencing (Illumina, San Diego, CA, USA); and linkage map information were developed and used to construct genome assemblies ...
-
bioRxiv - Immunology 2023Quote: ... scRNA-seq was completed at Stanford Functional Genomics Facility (SFGF) using the Chromium Single Cell Gene Expression kit (10X Genomics, CA, USA) and Illumina Novaseq (Illumina Inc, CA, USA) sequencer according to manufacturer’s protocols.
-
bioRxiv - Genetics 2023Quote: ... The construction of the sequencing library was adapted from Illumina’s amplicon sequencing protocol #15044223 Rev ...
-
bioRxiv - Genetics 2023Quote: ... 5 μl Nextera XT V2 Index (Illumina, FC-131-2001) primer N7xx ...
-
bioRxiv - Genetics 2023Quote: ... The denatured combined library was loaded into the MiSeq Reagent Kit v3 (600 cycle) (Illumina, MS-102-3003). The cluster density was ∼1100 K/mm2.
-
bioRxiv - Genetics 2023Quote: ... Poly-A selection and cDNA synthesis were performed using the TruSeq Stranded mRNA kit as outlined by the manufacturer (Illumina RS-122-2103). All steps were automated on the Perkin Elmer Sciclone NGSx Workstation ...
-
bioRxiv - Genetics 2023Quote: ... The Illumina TruSeq Methyl Capture EPIC library prep kit (Illumina, Santa Clara, CA, USA) was used following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... cDNA libraries were prepared with the TruSeq stranded mRNA library prep Kit (cat# RS-122-2101, Illumina, San Diego, CA, USA). The resulting libraries were sequenced on a HiSeq 4000 (Genomics & Cell Characterization Core Facility ...
-
bioRxiv - Genomics 2023Quote: ... Clustering and sequencing were performed on a NovaSeq6000 (Illumina,) using NovaSeq Reagent Kits (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Polyadenylated RNA was captured using oligo(dT) magnetic beads and libraries were synthesized using Stranded mRNA Prep Ligation (Illumina). RNAs were chemically fragmented and synthesis of the first strand of cDNA was made in the presence of actinomycin D ...
-
bioRxiv - Genetics 2023Quote: ... we demultiplexed raw sequencing reads using the bcl2fastq program (Illumina) and used CRISPResso297 to align reads with a minimum average quality score of 20 (phred 33 ...
-
bioRxiv - Genomics 2023Quote: ... the pDNA was sequenced by Illumina HiSeq2500 High Output.
-
bioRxiv - Genetics 2023Quote: ... in a NextSeq 500 platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Genetics 2023Quote: ... libraries were sequenced as 150-bp single-end reads using the High Output v2 Kit (Illumina, San Diego, CA, USA) in a NextSeq 500 platform (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... The mRNA-sequencing was performed by Novogene (Cambridge, UK) using the NovaSeq 6000 platform (Illumina, United States), generating paired-end 150 bp reads ...
-
bioRxiv - Genetics 2023Quote: ... The scaffolds were further polished and corrected using five rounds of Pilon (Walker et al. 2014) using both raw reads from Nanopore/PacBio sequencing and short paired-end reads from Illumina HiSeq 2000 ...