Labshake search
Citations for Illumina :
2551 - 2600 of 3793 citations for Laemmli Sample Buffer 2X Solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... strand-specific single-end RNA-seq libraries were prepared with the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, Cat ...
-
bioRxiv - Genetics 2021Quote: ... Illumina libraries for whole bodies were constructed using the TruSeq Nano Sample Prep kit (Illumina, San Diego, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control v3 (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2020Quote: ... One microgram of total RNA was used for library preparation following the TruSeq Stranded mRNA Sample Preparation Protocol (Illumina). Sequencing was performed on an Illumina HiSeq 2000 platform at Wageningen University & Research ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA methylation profiling of all samples was performed using the Infinium MethylationEPIC (850k) BeadChip (Illumina, San Diego, CA, USA) or Infinium HumanMethylation450 (450k ...
-
bioRxiv - Cell Biology 2020Quote: Illumina libraries were prepared from between 0.5 and 10ng of amplified cDNA using the Nextera XT DNA sample preparation protocol (Illumina) and a 1:1 Ampure XP purification step was performed ...
-
bioRxiv - Genomics 2021Quote: ... Purified gDNA from each haploid founder was then prepared for sequencing using the Nextera DNA Sample Preparation Kit (Illumina). Some minor modifications to the manufacturer’s protocol were implemented to optimize throughput (cf ...
-
bioRxiv - Physiology 2021Quote: ... and sequenced to a total of 25 million reads per sample on a Novaseq platform (Illumina, San Diego, CA).
-
bioRxiv - Neuroscience 2021Quote: The clustering of the index-coded samples was performed on a cBot Cluster Generation System (Cat.No. SY401-2015, Illumina) using TruSeq PE Cluster Kit v3-cBot-HS (Cat.No ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the samples were pair-end sequenced (Micro V2, 300 cycles) on a MiSeq equipment (Illumina, San Diego, USA) in around 18 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... Ribosomal RNA was depleted from the samples using TruSeq total RNA rRNA-depletion protocol (Illumina, Cat. #RS-122-2201) and then RNA samples were purified using Agencourt RNAClean XP beads (Beckman Coulter).
-
bioRxiv - Genomics 2021Quote: ... to prepare PCR-free paired-end libraries using the Illumina Genomic DNA Sample Preparation kit following the manufacturer’s instructions (Illumina). All paired-end libraries were sequenced on an Illumina NovaSeq 6000 system ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA (500 ng per sample) was used to synthesize libraries using a TruSeq Stranded mRNA Kit v2 (Illumina). Cluster generation was performed at the Functional Genomics Center Zurich (FGCZ ...
-
bioRxiv - Cancer Biology 2021Quote: mRNA-sequencing (mRNA-seq) libraries were prepared with the TruSeq RNA Sample Preparation v2 kit (RS-122-2002, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA was subjected to library preparation using Illumina TruSeq RNA and DNA Sample Prep Kits (Illumina, CA, USA). Library quality was confirmed using a Qubit 2.0 fluorometer (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... Strand-specific mRNA sequencing was performed of total RNA and using TruSeq stranded mRNA sample prep kit LT (Illumina), as previously described (52) ...
-
bioRxiv - Genomics 2020Quote: ... The RNA-seq libraries were prepared in two biological replicates using the standard TrueSeq RNA sample preparation kit (Illumina) and sequenced in 100bp pair end on illumina Hi Seq 2000 platform ...
-
bioRxiv - Genomics 2020Quote: ... A cDNA library was also prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) following Illumina’s low-throughput protocol ...
-
bioRxiv - Genomics 2021Quote: ... ChIP-seq libraries were constructed using the Illumina’s TruSeq ChIP sample preparation kit (Illumina, catalog no. IP-202-1012). Libraries were size selected using the SPRIselect beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was CIP treated and rRNA was depleted from each sample using ribo-zero rRNA depletion kits (Illumina). The remaining transcripts were then ligated to a unique 2’ ...
-
bioRxiv - Immunology 2020Quote: ... then the RNA sequencing was carried out using the TrueSeq RNA Sample Prep Kit (Illumina, San Diego, California, USA)55.
-
bioRxiv - Microbiology 2021Quote: ... Sample libraries were pooled and diluted to 200pm and 100µl of this diluted sample was loaded onto a flow cell for NGS using an iSeq 100 (Illumina). Sequences were assembled using reference mapping with paired ends in Geneious R10 (Biomatters ...
-
bioRxiv - Cancer Biology 2020Quote: ... ChIP-seq library preparation of ChIP DNA or input DNA was performed using TruSeq ChIP Sample Prep Kit (Illumina) following standard procedures from manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... High quality samples were then sequenced to a minimum of 50,000 reads per cell on a NextSeq 500 sequencer (Illumina) using a 75-cycle High Output kit using a custom read1 primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC).
-
bioRxiv - Genomics 2021Quote: ... according to the manufacturer’s instruction and was subjected to library construction with TruSeq RNA Sample Prep Kit v2 (Illumina) and 101 bp paired-end sequencing by Hiseq2500 ...
-
bioRxiv - Genomics 2021Quote: ... Paired-end libraries were prepared using the Illumina TruSeq RNA sample library preparation kit (Illumina, San Diego, CA, USA). Each sample was barcoded ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-Seq libraries were prepared with 500 ng total RNA using the TruSeq stranded mRNA Sample Preparation Kit according to the manufacturer’s protocol (Illumina). RNA-seq libraries were multiplexed ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were sequenced as 150bp paired end reads on multiplexed lanes of an Illumina HiSeq3000 (Illumina Inc, CA, USA). All sequencing data has been submitted to the European Nucleotide archive under the study accession PRJEB41493.
-
bioRxiv - Genomics 2020Quote: ... 1.25 µL of indicated input cDNA were used in a 5.0 µL Tagmentation reaction (Nextera XT DNA Sample Preparation Kit, Illumina) followed with a 12.5 µL dual-indexing PCR amplification reaction (Nextera XT DNA Sample Preparation Index Kit ...
-
bioRxiv - Microbiology 2021Quote: ... This depleted rRNA fraction was used to construct cDNA libraries using TruSeq Stranded Total RNA sample prep kit (Illumina). Libraries were then sequenced by Illumina HiSeq2500 sequencer ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-free libraries were prepared from 1μg DNA using the TruSeq PCRfree DNA sample preparation kit (cat# FC-121-3001/3002, Illumina) targeting an insert size of 350bp ...
-
bioRxiv - Microbiology 2022Quote: We sequenced the pooled sample containing PCR products using Illumina MiSeq technology (Illumina Reagent Kit v2, 500 reaction kit) at the Center for Bioinformatics and Genomics at Indiana University ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA sequencing libraries and 500 ng of total RNA for each of the samples were prepared per manufacturer’s suggested protocol using the TrueSeq mRNA Protocol Kit (Illumina). Purified libraries were pooled at a 0.9 pM concentration and sequenced on an Illumina NextSeq550 instrument and 75 bp paired end sequencing was performed ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sample libraries were sequenced on a HiSeq 2500 or a NextSeq 550 sequencing device (Illumina, San Diego, CA, USA) with a paired end read output of 2 × 250 bp (HiSeq ...
-
bioRxiv - Cancer Biology 2022Quote: ... All libraries were sequenced with a depth of at least 50,000 reads per spot (minimum of ~250 millions per sample) at the NovaSeq (Illumina). The Visium Human Transcriptome Probe Set v1.0 contains probes to 19,144 genes and after computational preprocessing (filtering for probes off-target activity ...
-
bioRxiv - Genomics 2022Quote: ... 600 pg cDNA from each sample plate was used in a modified Nextera XT (Illumina, Cat. FC-131-1024) library preparation but using the P5NEXTPT5 primer and the tagmentation time of 5 mins ...
-
bioRxiv - Genomics 2022Quote: ... Short-read cDNA libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) following Illumina’s low-throughput protocol ...
-
bioRxiv - Genomics 2022Quote: A short-read sequence library of ‘Takanotsume’ was prepared using the TruSeq DNA PCR-Free Sample Preparation Kit (Illumina) and sequenced on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Plant Biology 2022Quote: The triplicate total RNA samples used for single-end 1×75bp RNA-Seq on a NextSeq500 sequencing platform (Illumina). After examining the data quality using FastQC (v0.11.5) ...
-
bioRxiv - Molecular Biology 2022Quote: ... generally according to the manufacturer’s instructions and using custom primer pairs compatible with TrueSeq Small RNA Sample Preparation Kit (Illumina), bearing a unique tag for each library ...
-
bioRxiv - Microbiology 2022Quote: ... rRNA depleted samples were further processed and prepared using TruSeq Stranded mRNA library preparation kit (Illumina, RS-122-2101). The fragmentation time was reduced to 3min ...
-
bioRxiv - Microbiology 2022Quote: ... Shotgun metagenomes were sequenced from the extracted samples on the Illumina NovaSeq 6000 (Illumina, San Diego, CA, United States), with a 150 bp paired-end sequencing strategy ...
-
bioRxiv - Pathology 2022Quote: ... This library was sequenced with 43 other samples on a Hiseq3000 instrument (2×150 bp paired-end reads) (Illumina) at the GeT-PlaGe INRAE Sequencing facility (Toulouse ...
-
bioRxiv - Plant Biology 2022Quote: ... and purified RNA was used to make sequence libraries using True-Seq RNA sample preparation kit from Illumina (Agilent). Sequencing was carried out using HiSeq 2500 standard mode ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 ul of each normalized sample was mixed with 2.4 ul of tagmentation mix containing Tn5 Tagmentation enzyme (20034198, Illumina) and then incubated at 55°C for 12 minutes ...
-
bioRxiv - Plant Biology 2022Quote: ... library with insertion size of 350 bp was constructed using the Illumina Genomic DNA Sample Preparation kit following the manufacturer’s instructions (Illumina), and sequenced on an Illumina NovaSeq system with a read length of 150 bp ...
-
bioRxiv - Neuroscience 2022Quote: ... and these reads were counted by htseq-count v0.5.3 (with intersection-strict mode and stranded option for RiboZero samples) according to gene annotation (Illumina iGenome), and RPKM was calculated ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing libraries for each isolate were created using the Nextera XT Sample Preparation Kit (Illumina, San Diego, CA, USA) using the standard workflow ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 120 million 125-bp paired-end reads per sample were obtained (HiSeq 2500, Illumina, San Diego, CA, USA). RNA-seq was performed by the Genomic core ...
-
bioRxiv - Plant Biology 2022Quote: ... Illumina paired-end shotgun-indexed libraries were prepared using the TruSeq DNA PCRF-Free LT Sample Preparation Kit according to the manufacturer’s instructions (Illumina). The libraries were validated using an Agilent High Sensitivity DNA chip (Agilent Technologies ...