Labshake search
Citations for Illumina :
1801 - 1850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... sgRNA inserts were PCR amplified (primers listed in Supplementary Table 5, purified and sequenced on a NextSeq (Illumina). Sequencing reads were mapped and the abundance of each sgRNA was tallied ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequence libraries were multiplexed and sequenced on NovaSeq (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... Paired-end 50bp runs were performed on Novaseq S1 (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... Pooled libraries were sequenced using Illumina short-read technology based on PE150 on the NovaSeq6000 (Illumina). After sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Prepared libraries were subjected to high throughput sequencing using Illumina NovaSeq 6000 system using S4 flow cell (Illumina, San Diego, CA, USA) and v1.5 chemistry ...
-
bioRxiv - Cell Biology 2024Quote: ... The base calling data from the sequencer were transferred into FASTQ files using bcl2fastq2 conversion software (version 2.20, Illumina). PartekFlow (a start-to-finish software analysis solution for next generation sequencing data applications ...
-
bioRxiv - Cell Biology 2024Quote: ... FACS sorted based on Klf2:GFP reporter levels with subsequent analysis of sgRNAs in the high Klf2:GFP gate by next-generation sequencing on HiSeq2500 (Illumina). Klf2 suppressor (gain-of-function ...
-
bioRxiv - Cell Biology 2024Quote: ... The libraries were then sequenced on an Illumina HiSeq 2500 sequencing platform (Illumina, San Diego, CA, USA) to generate paired-end reads of 100 bp length.
-
bioRxiv - Cell Biology 2024Quote: ... Sequencing was performed using an Illumina 6000 (Illumina, USA) with 150-bp paired-end reads ...
-
bioRxiv - Cell Biology 2024Quote: RNA sequencing libraries were prepared using the Illumina TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were sequenced on a NovaSeq 6000 (Illumina) with the S2 100 cycle kit targeting 50,000 reads per cell.
-
bioRxiv - Cell Biology 2024Quote: The raw sequencing reads from Illumina were aligned to the mouse reference genome mm10 using Cell Ranger V4 software (RRID:SCR_017344 ...
-
bioRxiv - Cell Biology 2024Quote: ... Barcoded libraries were then pooled and sequenced on the HiSeq2000 (Illumina) using TruSeq SBS Kit v4 reagents ...
-
bioRxiv - Cell Biology 2024Quote: ... Strand-specific 354 mRNA sequencing was performed on total RNA and using TruSeq stranded mRNA sample prep 355kit LT (Illumina) (Roques et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA libraries were prepared using the TruSeq Stranded Total RNA kit (Illumina). Paired-end sequencing was performed using the Illumina NextSeq 550 (Illumina) ...
-
bioRxiv - Cell Biology 2024Quote: ... Paired-end sequencing was performed using the Illumina NextSeq 550 (Illumina). Three biological duplications were analyzed for all strains ...
-
bioRxiv - Cancer Biology 2024Quote: ... including a 10% PhiX spike-in (Illumina) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... the libraries underwent sequencing on the HiSeq platform (Illumina, San Diago, CA, USA) following the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... the flowcell was loaded on the Illumina NovaSeq 6000 instrument according to manufacturer’s instructions (Illumina). Sequencing was performed using a 2×150 Paired End (PE ...
-
bioRxiv - Cancer Biology 2024Quote: ... NEB NextUltra DNA Library Preparation kit was used following the manufacturer’s recommendations (Illumina). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... 300 cycles (Illumina). FASTQs generated were analysed with the ‘UMI4Cats’ R package to generate contact maps against the IRX3 proximal promoter (49).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sequenced on a MiSeq (Illumina) with a MiSeq Reagent Nano Kit v2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Combined libraries from different cells were then sequenced on a NextSeq 500 sequencer (Illumina), using paired-end 38-base reads.
-
bioRxiv - Cancer Biology 2024Quote: ... RNA sequencing libraries prepared with the Illumina TruSeq stranded mRNA kit (Illumina) following the manufacturers’ instructions at the DFCI core facility ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA sequencing libraries were processed for rRNA removal (QiaSelect) and prepared with the Illumina TruSeq stranded mRNA kit (Illumina) following the manufacturers’ instructions at DFCI core facility ...
-
bioRxiv - Neuroscience 2024Quote: Reads were demultiplexed with CASAVA (Illumina) and read quality was assessed using FastQC (https://www.bioinformatics.babraham.ac.uk/ ...
-
bioRxiv - Microbiology 2024Quote: ... Library Preparation was completed using the KAPA mRNA HyperPrep Kit (Illumina) enriching for Poly(A ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a cDNA library prepared using Nextera XT DNA Sample Preparation Kit (Illumina). Sequencing was carried out on the MiSeq platform using MiSeq Reagent Kit v2 (300 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing was carried out on the MiSeq platform using MiSeq Reagent Kit v2 (300 cycles) chemistry (Illumina) and paired-end sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... were sequenced with an Illumina Miseq (Illumina) using a modified version of a previously described PCR-free protocol (38) ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries prepared with unique barcodes were pooled at equal molar ratios following manufacturer’s protocol (Cat# 15035786 v02, Illumina). The pool was denatured and subject to paired-end 50x (DO samples ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 brain regions per mouse using the TruSeq stranded mRNA LT kit (Cat# RS-122-2101, Illumina). These synthetic RNAs cover a range of concentrations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing was performed using NextSeq-500 or 2000 (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... Base calling and de-multiplexing were performed using the bcl2fastq2 (Illumina) v2.20 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantified libraries were pooled and sequenced using an Illumina NovaSeq 6000 System in 150 bp paired-end mode (Illumina). Base calling and de-multiplexing were performed using the bcl2fastq2 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... libraries were prepared by Psomagen using the Truseq Stranded Total RNA Library Prep Kit and sequenced on a NovaSeq6000 S4 (Illumina). Low quality bases and adaptors were trimmed from sequence reads using Cutadapt v2.7 with parameters “–q 20 -minimum-length 25” (122) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were sequenced on a HiSeq 3000 or NextSeq 550 (Illumina). Raw data can be accessed under SRA Bioproject accession number PRJNA922944.
-
bioRxiv - Biophysics 2024Quote: Sequencing data from Illumina Miseq was processed to extract tile and coordinates of each sequenced cluster ...
-
bioRxiv - Genetics 2024Quote: ... The raw genotyping data deriving from the Brassica Illumina infinium arrays or from the KASPar technology were analyzed using either the GenomeStudio v.2011.1 (Illumina Inc., San Diego, CA, USA) or the Fluidigm SNP Genotyping Analysis v4.1.2 softwares (Wang et al ...
-
bioRxiv - Genetics 2024Quote: ... We performed multiplex sequencing using an Illumina HiSeq X-Ten sequencer (Illumina, San Diego, CA, USA). Variant calling and annotation were done in-house using the Peking Union Medical College Hospital Pipeline (PUMP ...
-
bioRxiv - Genetics 2024Quote: ... genotyping was performed by Illumina Human610 Genotyping BeadChip ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared using the TRUSeq stranded mRNA kit (Illumina) and sequenced on an Illumina HiSeq2500 instrument ...
-
bioRxiv - Bioengineering 2024Quote: Sequencing reads were demultiplexed using MiSeq Reporter (Illumina). Amplicon sequences were aligned to their reference sequences using CRISPResso254 ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting cell nuclei were subjected to incubation for 30 min with Tagment DNA TDE1 Enzyme and Buffer (Illumina, #FC-121-1030). This step fragmented the chromatin and inserted sequencing adapters ...
-
bioRxiv - Bioengineering 2024Quote: ... we prepared the library using Nextera XT DNA Library Preparation kit (Illumina) with 100-150pg starting material ...
-
bioRxiv - Bioengineering 2024Quote: ... We use RTA (Illumina) for base calling and bcl2fastq2 (version 2.19 ...
-
bioRxiv - Cancer Biology 2024Quote: ... MultiQC (v1.7; Illumina) was used for data quality assessments ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real Time Analysis Software (RTA) and NovaSeq Control Software (NCS) (1.8.0; Illumina) were used for base calling ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA libraries were constructed using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero (#20020596, Illumina). Nextseq 550 sequencing system (Illumina ...