Labshake search
Citations for Illumina :
851 - 900 of 1461 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 19086) and amplified using 2.5 µl of Universal PCR primer (NEBNext Multiplex Oligos for Illumina, NEB, cat. no. E6861A), 2.5 µl of indexed primers (NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and Q5 high-fidelity polymerase according to the manufacturer’s instructions (different F2 primers were used in order to add a unique Illumina index sequence to each HindIII-treated and untreated sample) ...
-
bioRxiv - Plant Biology 2023Quote: ... with the MiSeq reagent kit version 3 (600 cycles; Illumina). The reads were cleaned up using the cutadapt ver ...
-
bioRxiv - Cancer Biology 2021Quote: ... these analyses were performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Neuroscience 2020Quote: ... The Illumina Human CytoSNP-12v2.1 BeadChip array and KaryoStudio analysis software (Illumina) were used to assess genome integrity (Supplementary Table 1).
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Genomics 2022Quote: ... we benchmarked 23 different human genotyping arrays including 14 arrays from Illumina and 9 arrays from Affymetrix ...
-
bioRxiv - Genomics 2020Quote: ... Illumina TruSeq Stranded Total RNA Ribo-Zero Human/Mouse/Rat Gold (Illumina) was used to construct ribosomal RNA depleted sequencing libraries ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DNA methylation was quantified using Infinium Human Methylation 27 BeadChip (Illumina, CA) at the Northwestern University Core facility.
-
bioRxiv - Genetics 2021Quote: ... whereas the Illumina Human HT-12 v4 beadchip (Illumina, San Diego, CA) is a genome-wide array targeting about 31,000 genes (with on average 2 probes per gene ...
-
bioRxiv - Genomics 2021Quote: ... DNA methylation levels were measured using Infinium Human Methylation 450 arrays (Illumina) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase H or the Ribo-Zero method (human, mouse, plants) (Illumina, USA) was used to remove rRNA ...
-
bioRxiv - Genetics 2024Quote: ... or in the Human Imprintome array BeadChip (Illumina, Inc., San Diego, CA), amplified ...
-
bioRxiv - Bioengineering 2024Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used for library construction ...
-
bioRxiv - Cancer Biology 2024Quote: ... samples were hybridized to Human HT-12 V.4.0 BeadChip arrays (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Immunology 2021Quote: ... The library pool was quantified by qPCR and sequenced on a MiSeq platform (Illumina, San Diego, CA, USA) with 2x 150 cycles ...
-
bioRxiv - Developmental Biology 2020Quote: ... quantified using KAPA QPCR and paired-end 100 bp reads were sequenced using a HiSeq 2500 instrument (Illumina). RNA reads were aligned with TopHat260 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then indexed using forward (i7) and reverse (i5) index primers from the Nextera Index Kit (Illumina FC-121-1011). Index ligation and fragment amplification were achieved using the method’s PCR amplification thermal cycling program.
-
bioRxiv - Neuroscience 2021Quote: ... Universal adapters were ligated followed by 10 cycles of PCR using Illumina PCR Primer Cocktail and Phusion DNA polymerase from Illumina. Subsequent library purification with Agencourt AMPure XP beads was validated with Agilent Bioanalyzer 2100 ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Genomics 2020Quote: ... DNA was amplified by PCR using Nextera primers and libraries were sequenced using a Next-Seq 500/550 high output kit v2 75 cycles (Illumina).
-
bioRxiv - Systems Biology 2020Quote: ... Sequencing was performed using custom read primer oligo1210 (5’-CTTGTGGAAAGGACGAAACACCGGTAATTTCTACTCTTGTAGAT) (HPLC purified, Integrated DNA Technologies) using NextSeq 1 × 75 nt High Output reagents (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... a V3-V4 region of 16S rRNA gene was amplified using standard degenerate primers fused with sequencing adapters (see Illumina guide for 16S Metagenomic Sequencing Library Preparation ...
-
bioRxiv - Microbiology 2021Quote: ... 50 ng of each amplicon was dual indexed in a 5-cycle PCR reaction using the PCR module and indexed primers from the Nextera kit (Illumina). Resulting libraries were purified on AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... Edits were confirmed by sequencing after amplification using index primers based on the NexteraXT index kit V2 setA (#15052163, Illumina) and the high fidelity Taq polymerase Kapa (#KK2602 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were prepared for SORT-seq as previously described.23 Illumina sequencing libraries were then prepared with the TruSeq small RNA primers (Illumina) and sequenced single-end at 75 bp read length with 75.000 reads per cell on a NextSeq500 platform (Illumina) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 5’ CGT ACA GCG GCT TGT TGG CTG TGA, and fA23M, 5’ GCG CTC CAG CTC CTT CTG CCC ATA, primers to which the Illumina sequencing primer sequences were attached to their 5’ ends) ...
-
bioRxiv - Microbiology 2022Quote: ... The primers Uni530F and Uni907R (Nunoura et al., 2012) containing Illumina TruSeq adapter sequences (Illumina Inc., San Diego, CA, USA) were used for PCR ...
-
bioRxiv - Microbiology 2021Quote: The second stage PCR procedure attached unique index primers to each sample using the Nextera XT v2 set A kit (Illumina). Purified DNA (5 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Tagmented DNA fragments were enriched by 10 cycles of PCR amplification using PCR master mix and primers with the index from Illumina. Libraries were quantified by the KAPA SYBR fast quantitative PCR kit (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... library preparation was done following the CEL-Seq2 protocol [41] to prepare a cDNA library for sequencing using TruSeq small RNA primers (Illumina). The DNA library was paired-end sequenced on an Illumina Nextseq™ 500 ...
-
bioRxiv - Cell Biology 2020Quote: To the cancer hot spot library P5 and P7 sequences were attached by PCR using the custom pBB9 primer and Nextera N701 (Illumina). Library was purified with 0.6x volume fraction AMPure beads ...
-
bioRxiv - Genetics 2020Quote: Nextera barcode adapters were added to can1 amplicons and were then minimally PCR amplified (8 cycles) for attachment of Illumina Nextera XT index primers set A (Illumina). After PCR ...
-
bioRxiv - Genomics 2021Quote: ... and each sample was uniquely indexed using Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001). Indexed libraries were purified with Omega Mag-Bind Total Pure NGS Beads ...
-
bioRxiv - Genomics 2021Quote: The read sequences in FASTQ format were first trimmed by removing six bases from random primers of TruSeq DNA Methylation Kit (Illumina) and the last 50 bases of low-quality reads ...
-
bioRxiv - Genomics 2021Quote: ... Bisulfite-treated DNA samples (50 ng) were subjected to 10 cycles of PCR using random primers from the TruSeq DNA Methylation Kit (Illumina) to add adapters ...
-
bioRxiv - Systems Biology 2021Quote: ... All samples were stored in 2ml of TE buffer at −80°C for later sequencing of the V6-V8 hypervariable region of the 16S rRNA gene using the universal microbial primers from Illumina.
-
bioRxiv - Molecular Biology 2021Quote: ... was used to extract mRNA from 1 μg total RNA and NEB Ultra Library Preparation Kit for Illumina was used to prepare sequencing libraries with different indexing primers to enable pooling of up to 10 libraries per lane of 50 bp SE HiSeq 2000 Sequencer (Illumina) runs ...
-
bioRxiv - Molecular Biology 2021Quote: ... The index sequences were defined by the combination of primers with TruSeq HT index 1 (D 7xx) and TruSeq HT index 2 (D 5xx) (Illumina). Index PCR was performed using KAPA HiFi HS ReadyMix (Kapa Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared following the RNA-seq sample work flow using the Scriptseq Complete kit for bacteria and indexed with unique Scriptseq Index PCR primers (Illumina).
-
bioRxiv - Genomics 2021Quote: ... DNA was PCR amplified for a total of 11-13 cycles using barcoded primers (Illumina Nextera XT Index Kit v2) and purified using Ampure beads (1.4:1 beads:sample ratio) ...
-
bioRxiv - Genomics 2022Quote: All samples (n=75) underwent 16S rRNA gene sequencing using 515F-806R primers on the MiSeq (Illumina, San Diego, USA) as previously described (Seaton et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Bacterial 16S rRNA amplicons were constructed via amplification of the V4 region of the 16S rRNA gene with the universal primer set (U515F/806R) and flanked by Illumina standard adapter sequences as in a method previously described elsewhere33,34 ...
-
bioRxiv - Microbiology 2023Quote: ... V3-V4 region of 16S rRNA was amplified using primer 341F and 805R and libraries were prepared using Nextera XT Index Kit v2 (Illumina). The libraries were sequenced on Illumina Mi-Seq instrument using Miseq Reagent Kit v3 (600 cycles ...
-
bioRxiv - Microbiology 2022Quote: ... Gel-extracted DNA (size selection ~250 to 300bp) was amplified by PCR using primers and cycling conditions recommended by Illumina. Purified PCR products were submitted to the UW-Madison Biotechnology Center for a single end 50-bp Illumina MiSeq run ...
-
bioRxiv - Microbiology 2023Quote: Amplification of the V4 region of the 16S rRNA gene was carried out in triplicates with primers containing illumina adapters (515F-Illumina 5’-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG GTG CCA GCM GCC GCG GTA A-3’ and 806R-Illumina 5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGG ACT ACH VGG GTW TCT AAT-3’) ...
-
bioRxiv - Bioengineering 2023Quote: ... primers were designed containing a universal linker sequence allowing amplicons for incorporation indexes and sequencing primers by Nextera XT Index kit (ILLUMINA); and 16S rRNA gene universal primers (Klindwoth2013) ...
-
bioRxiv - Genetics 2023Quote: ... Locus specific PCR product was used for indexing PCR using KOD Hot Start DNA Polymerase and TruSeq i5 and i7 indexing primers (Illumina) following the cycling conditions ...