Labshake search
Citations for Illumina :
901 - 950 of 1461 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... UV-cleaved oligonucleotides from each spatially resolved ROI were aspirated and collected in a 96-well collection plate to perform library prep with Seq Code primers and sequenced on an NextSeq500 sequencer instrument (Illumina). Digital count conversion files (DCC ...
-
bioRxiv - Microbiology 2023Quote: ... One microliter of each eluted sample was used in polymerase chain reaction amplification of the variable region 4 of bacterial and archaeal 16S ribosomal RNA genes with barcoding primer set 515/806 based on the original Earth Microbiome Project protocol (Caporaso et al. 2011; “16S Illumina Amplicon ProtocolL ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCF7 and BT-474 libraries were independently amplified with index primers N7xx and S5xx of Nextera XT Index Kit v2 Set A (FC-131-2001, Illumina) and Nextera XT Index Kit v2 Set B (FC-131-2002 ...
-
bioRxiv - Microbiology 2022Quote: ... bacterial genomic DNA was used for amplification of the V4 hypervariable region with universal primers (U515F/806R) flanked by Illumina standard adapter sequences and the products were pooled for sequencing on the Illumina MiSeq platform ...
-
bioRxiv - Genomics 2022Quote: ... Primers were separated from the library using AMPure XP size selection prior to 50 bp paired-end sequencing (HiSeqv4, Illumina).
-
bioRxiv - Microbiology 2022Quote: ... followed by polymerase chain reaction with primers containing Illumina adapters to construct DNA libraries for paired-end sequencing on a NextSeq machine (Illumina).
-
bioRxiv - Systems Biology 2024Quote: ... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on an Illumina MiSeq or NovaSeq using custom sequencing primers (R1 - U6-Illumina-seq2 - TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG and R2 - iScaffold-Illumina-seq3 - GCTCTTCCGATCTGCTGTTTCCAGCATAGCTCTTAAAC)
-
bioRxiv - Genomics 2024Quote: ... we used primers flanking both sgRNA scaffolds and sequenced on a 300-cycle sequencing kit (e.g. Illumina MS-102-2002). For subsequent library sequencing without quantification of deletion events ...
-
bioRxiv - Molecular Biology 2024Quote: ... Illumina indexes were added by amplifying 1 ng DNA to a 50 μl PCR reaction using Kapa HS enzyme and unique dual indexing primers (Illumina) for 11 cycles (Denaturation 95°C 3min ...
-
bioRxiv - Molecular Biology 2024Quote: ... AMPure beads (Beckman Coulter, A63880 were used to remove primer dimers and libraries were sequenced on a NextSeq 500 instrument (Illumina) to generate 75 bp single-end reads.
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: 20-50ng PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: 20-50ng PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) total 20µl ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: Eluted PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... bacterial 16S rRNA amplicons were built via amplification of the V4 region of the 16S rRNA gene using the U515F/806R primer pair39 and processed for paired-end sequencing by MiSeq (Illumina) as previously described11,39,40 ...
-
bioRxiv - Microbiology 2024Quote: ... Variant type was confirmed in a subset of samples with available nasopharyngeal swabs by SARS-CoV-2 complete genome next-generation sequencing using Artic v5.3.2 (IDT, Coralville, IA) and Artic v4.1 primer sets (Illumina, San Diego, CA).
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µl 100 µM barcoded CRISPR KO primer (oMCB1440, aatgatacggcgaccaccgagatctacacGATCGGAAGAGCACAC GTCTGAACTCCAGTCAC NNNNNN CGACTCGGTGCCACTTTTTC, where NNNNNN is an Illumina TruSeq index), and 69.4 µl nuclease-free water were added to the 5 µl PCR1 reaction ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: Bacterial 16S rRNA amplicons were generated at the University of Missouri Genomics Technology Core via amplification of the V4 hypervariable region of the 16S rRNA gene using dual-indexed universal primers (U515F/806R) flanked by Illumina standard adapter sequences and the following parameters ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers) and paired-end sequenced (42 bp) on the NextSeq 500 platform (Illumina) in accordance with the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... amplified with the prokaryotic universal primer sets encoding F515/R806 47 were sequenced on a NovaSeq 6000 platform (Illumina, CA) at Novogene Co ...
-
bioRxiv - Immunology 2023Quote: ... 200 pg of purified WTA products from each pool were subjected for library construction with custom designed New-P5-SMART-PCR primer using the Nextera XT DNA library preparation kit (Illumina) following the detailed protocol provided by the manufacture ...
-
bioRxiv - Developmental Biology 2024Quote: ... library preparation was done following the CEL-Seq2 protocol43to prepare a cDNA library for sequencing using TruSeq small RNA primers (Illumina). The DNA library was paired-end sequenced on an Illumina Nextseq™ 500 ...
-
bioRxiv - Immunology 2022Quote: ... cDNA libraries were amplified 12 cycles of PCR with Terra PCR Direct polymerase Mix in the presence of i5 or i7 PCR primers (Illumina) to add sample specific indexes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The generated libraries were amplified using the KAPA HiFi Hotstart Ready Mix and Nextera Index Kit 1 (i7) and 2 (i5) primers (Illumina). Amplified libraries were purified using a 0.65x AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2022Quote: ... 1 ng cDNA was converted to a sequencing library using the NexteraXT DNA Library Prep Kit and NexteraXT indexing primers (Illumina) with 10 additional cycles of PCR ...
-
bioRxiv - Immunology 2022Quote: ... Purified DNA was further amplified by PCR using Kapa Hifi Hotstart Ready Mix with Nextra XT Index Primers from Nextra XT Index Kit (Illumina). The PCR condition was ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... In the first round of PCR we used primers that align to Illumina Truseq Read 1 primer site located directly upstream of the barcode in the lentiviral backbone and a primer annealing downstream of the barcode containing an overhand with Illumina Truseq Read 2 sequence (see ‘Illumina barcode sequencing 1st round PCR primers’ in the Supplemental Table 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... library preparation was done following the CEL-Seq2 protocol [50] to prepare a cDNA library for sequencing using TruSeq small RNA primers (Illumina). The DNA library was paired-end sequenced on an Illumina Nextseq™ 500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... genotyped by PCR (genotyping primer sequences are presented in Table S4) and confirmed by Sanger Sequencing (Quintara Bio) or MiSeq (Illumina). Southern Blot using a CITRINE probe was carried out to verify single integration for the reporter cell lines.
-
bioRxiv - Microbiology 2023Quote: ... Indices were added in a second PCR over 8 cycles with unique primer combinations using the Nextera XT Index Kit V2 (Illumina). The samples were pooled and cleaned using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Systems Biology 2023Quote: ... The NGS libraries were pooled and sequenced as single-read with the custom sequencing primer provided with the QuantSeq NGS library preparation kit with 100 cycles on a HiSeq2000 sequencer (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... cDNA library preparation with oligo-dT primers following the Illumina TruSeq stranded mRNA sample preparation guide (Illumina, San Diego, CA), and sequencing procedure with Illumina HiSeq 3000 platform with 30-50x106 bp reading depth were previously described in detail 19 ...
-
bioRxiv - Immunology 2024Quote: ... Library preparation was done following the CEL- Seq2 protocol69 to prepare a cDNA library for sequencing using TruSeq Small RNA primers (Illumina). The DNA library was paired-end sequenced on an Illumina NextSeq 500 ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers) and single-ended sequenced (75 bp) on the NextSeq 500 platform (Illumina) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... ATAC-seq library preparation was performed as described using the primers listed in Supplementary Table 10 and sequenced on the NovaSeq 6000 platform (Illumina) with 2 × 75 bp reads ...
-
bioRxiv - Plant Biology 2024Quote: ... The RT-PCR products recovered from the gel were dissolved in Milli-Q water and amplified by index PCR using IDT for Illumina DNA/RNA UD index primers (20027213, Illumina) and KOD Plus Neo DNA polymerase ...
-
bioRxiv - Genomics 2024Quote: ... RP1 and RPI-n primers are Illumina small RNA TruSeq design (Oligonucleotide sequences © 2015 Illumina, Inc. All rights reserved).
-
bioRxiv - Cell Biology 2024Quote: ... library preparation was done following the CEL-Seq2 protocol (Hashimshony, 2016) to prepare a cDNA library for sequencing using TruSeq small RNA primers (Illumina). The DNA library was paired-end sequenced on an Illumina Nextseq™ 500 ...
-
bioRxiv - Cell Biology 2024Quote: ... library preparation was performed following the CEL-Seq2 protocol44 to prepare a cDNA library for sequencing using TruSeq small RNA primers (Illumina). The DNA library was sequenced by paired-end sequencing on an Illumina Nextseq™ 500 ...
-
bioRxiv - Immunology 2024Quote: ... barcoded cDNA was amplified by PCR to generate enough mass for library construction (Nextera® PCR primers) (Illumina, CA, USA). Sequencing of the libraries was performed on HiSeq2500 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The sequencing was performed by Macrogen (the Netherlands) with Bac341F and Bac806R primers (Caporaso et al., 2012; Herlemann et al., 2011) using an Illumina MiSeq sequencer (Illumina). Paired-end (2x 301bp ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL of the resulting DNA were used for reamplification with primers containing NGS overhang adapters required for library preparation (#15044223 Rev. B, Illumina), using the same PCR program ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers) and sequenced (75 bp; single-end) on a NextSeq 500 platform (Illumina) in accordance with the manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... we matched the taxonomy of the 16S-based profiles (derived from both 16S primer sets) using the species identified by Illumina as the reference ...
-
bioRxiv - Microbiology 2024Quote: ... followed by polymerase chain reaction with primers containing Illumina adapters to construct DNA libraries for paired-end sequencing on a NextSeq machine (Illumina).
-
bioRxiv - Synthetic Biology 2024Quote: ... Barcodes were added to 3’ and 5’ ends of cDNA through single-step PCR with KAPA HiFi HotStart ReadyMix using primers including the Illumina P5 and P7 regions and barcodes adapted from Illumina TruSeq ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed in 3 sequencing unit of NovaSeq 6000 (Illumina) (100-nt-length reads ...
-
bioRxiv - Immunology 2023Quote: ... dual-indexed 3’ DGE libraries were prepared using Nextera XT (Illumina) and sequenced to depth on the NovaseqS4 platform with a paired-end read structure (R1 ...