Labshake search
Citations for Illumina :
1051 - 1100 of 1461 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Ribosomal RNA was depleted using a Ribo-Zero Gold (Human/Mouse/Rat) kit (Illumina), followed by a pull-down using RNAClean XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2020Quote: ... quantitated by real-time quantitative PCR (qPCR) using a TaqMan® Probe and amplified off-board on a cBot (TruSeq PE Cluster Kit v3–cBot–HS, Illumina) to generate clusters on the sequencing flow cell ...
-
bioRxiv - Cancer Biology 2021Quote: ... The Agilent BioAnalyzer HS DNA Kit was used to assess the library size distribution before qPCR quantification and sequencing at the Harvard Medical School Biopolymers Facility (paired end sequencing was performed on an Illumina NextSeq).
-
bioRxiv - Cell Biology 2022Quote: ... The pool was then quantified with qPCR and a final pool (2 nM) was made for single-read sequencing on the HiSeq4000 (Illumina Inc). The settings were 51-8-8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were analyzed using the Fragment Analyzer and quantified by qPCR prior to pooling and sequencing on a NextSeq® 500 System (Illumina) using 75nt single end reads ...
-
bioRxiv - Microbiology 2022Quote: ... The libraries were quantified by KAPA qPCR library quantitation assays and sequenced paired-end using MiSeq platform (Illumina, San Diego, CA) with a 150 cycle v3 sequencing kit ...
-
bioRxiv - Genetics 2021Quote: 5× HOT FIREPol® EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne) and an Eco Real-Time PCR System (Illumina) were used for qPCR ...
-
bioRxiv - Genomics 2023Quote: ... The sequencing-ready library was cleaned up with SPRIselect and quantified by qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms). 200 pM of sequencing libraries were loaded on an Illumina HiSeq instruments (see Single-cell RNA sequencing analysis section ...
-
bioRxiv - Microbiology 2021Quote: ... Fragments were then indexed with 10 nucleotide barcode sequences using Nextera XT Index Kit v2 Set D primers (Illumina, San Diego, California, USA). Indexing PCR reactions were run in triplicate with a volume of 25 μL using 12.5 μL NEB Next High-Fidelity Master Mix ...
-
bioRxiv - Developmental Biology 2020Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 pM and sequencing configuration as following ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were resuspended in 50 μl of the following PCR master mix with indexed primers from the Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011): Phusion HF 2X (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: The V1 and V2 region of the 16S rRNA gene were amplified using universal bacterial primers 27F and 355R (Rodriguez-Lanetty et al. 2013) with Fluidigm CS1 and CS2 adapters (Illumina, San Diego, CA). PCR was conducted with the following reaction conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA libraries were constructed and amplified using random primers according to the manufacturer’s instructions (Illumina TruSeq RNA sample preparation guide v2 for Illumina paired-end multiplexed sequencing). For sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Microbiology 2020Quote: ... the V3–V4 region of bacterial 16S rRNA genes was sequenced using primers 341F-806R [25] with MiSeq technology (Illumina, San Diego, CA). Internal company standards worked as expected (Supplementary Methods) ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification and index incorporation were performed in a 50 μl reaction containing 5 μl of forward and reverse index primers (Illumina Nextera Index Kit), 15 μl NPM ...
-
bioRxiv - Genomics 2022Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Physiology 2022Quote: ... and 1.0 μL of each index primer of the Nextera XT Index Kit v2 Set B and Set C (FC-131-2002, FC-131-2003; Illumina Inc., CA., USA.). The first step ...
-
bioRxiv - Zoology 2022Quote: ... Twelve 150 bp paired-end libraries (six for the Mamm01 primer set and six for the MiFish-U primer set) were prepared with an Illumina TruSeq DNA PCR-free LT Sample Prep kit (Illumina, San Diego, California), spiked with 8% phiX ...
-
bioRxiv - Neuroscience 2024Quote: Approximately 500 ng of total RNA was used for cDNA library preparation with oligo-dT primers following the Illumina TruSeq preparation guide (Illumina, San Diego, CA) (Mecklenburg et al. ...
-
bioRxiv - Genomics 2024Quote: ... and the final sequencing library was amplified utilizing the KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit along with index primers from the Nextera XT Index Kit (Illumina, FC-131-1001). The amplification protocol involved an initial step at 98°C for 45 seconds ...
-
bioRxiv - Bioengineering 2024Quote: ... then the target exon was extracted with B2M exon primers with attached Nextera XT DNA Library Preparation Kit (Illumina, San Diego, Ca, USA) index adapter sequences ...
-
bioRxiv - Microbiology 2023Quote: The V1 and V2 regions of the 16S rRNA gene were amplified using universal bacterial primers 27F and 355R74 with CS1 and CS2 adapters (Illumina, San Diego, CA). PCR was conducted with the following reaction composition ...
-
bioRxiv - Physiology 2022Quote: ... The hypervariable regions V3-V4 of the 16S rRNA coding gene were amplified using Illumina primers (fw: CCTACGGGNGGCWGCAG, rev: GACTACHVGGGTATCTAATCC) and sequencing (2 × 300 bp paired-end) was carried out on the MiSeq platform (Illumina, San Diego, California) with a coverage of 50k reads ...
-
bioRxiv - Cell Biology 2023Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75Lcycles) (Illumina, #FC-404-2005). The library loading concentration was 2.4 pM ...
-
bioRxiv - Cell Biology 2023Quote: ... were used instead of the primers that came with the SMARTer Stranded Total RNA HI Mammalian kit to allow for sequencing on the NovaSeq (Illumina, San Diego, CA) by the Biopolymers Facility at Harvard Medical School.
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Immunology 2024Quote: Paired-end sequencing of the hypervariable V4 region of the 16S rRNA gene was performed with the 515 forward and 806 reverse primers using an Illumina MiSeq instrument (Illumina, San Diego, CA) to produce 150 base-paired reads ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized from each individual sample using random hexamer primers and libraries were prepared by TruSeq RNA sample preparation kit (Illumina, San Diego, USA). RNA-seq analysis (50 bp ...
-
bioRxiv - Cancer Biology 2024Quote: ... New primers specific to the BRCA1 promoter region hg38 chr17:43125457 – 43125336 were designed for this assay (based on primers from [26], with Illumina sequencing adaptors added):
-
bioRxiv - Immunology 2021Quote: ... and sequencing libraries generated with a TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina). Libraries were sequenced on a NextSeq500 platform (Illumina) ...
-
bioRxiv - Biophysics 2021Quote: ... libraries were constructed using Ribo-Zero Magnetic Gold Kit (Human) (Illumina, San Diego, CA, USA) and NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Systems Biology 2022Quote: ... Human DNA samples for the COVID study were subjected to the Infinium MethylationEPIC array (Illumina) at AKESOgen Inc. ...
-
bioRxiv - Genetics 2021Quote: ... we genotyped the genomic DNA with the OmniChip from the Human OmniExpressExome-8v1.2 from Illumina Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA samples were analyzed using Human HT expression BeadChip V4 (Illumina, San Diego, CA, USA). Raw data were processed using the bead array package from Bioconductor (16) ...
-
bioRxiv - Plant Biology 2023Quote: ... Library preparation included the “TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat”-kit (Illumina), ribosomal RNA depletion and a size selection step for 300 bp fragments ...
-
bioRxiv - Molecular Biology 2024Quote: ... stand-alone Ribo-Zero kits [Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat)] (Illumina), Ribo-Zero accompanied by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNAs were depleted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Cell Biology 2024Quote: RNA libraries were generated using the human mRNA TruSeq Stranded library preparation KIT from Illumina and profiled using NovaSeq6000 and NovaSeq XPlus systems with 150 bp paired-end sequencing method ...
-
bioRxiv - Developmental Biology 2024Quote: ... Genotyping was performed on 40 samples using the Human Omni-Zhonghua chips (Illumina, CA, USA) for pedigrees 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Genome-wide DNA methylation patterns were evaluated by Infinium Human Methylation 850 K BeadChips (Illumina), which determine the methylation levels of 853,307 CpG sites ...
-
bioRxiv - Immunology 2024Quote: ... libraries were constructed using Ribo-Zero Magnetic Gold Kit (Human) (Illumina, San Diego, CA, USA) and NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Biophysics 2024Quote: ... we aligned the trimmed reads to the human reference genome (hg19, downloaded from Illumina’s iGenomes) using Hisat2 63 with “-k 1 – no-spliced-alignment –phred33” parameters and stored them as binary alignment maps (BAM) ...
-
bioRxiv - Cancer Biology 2024Quote: We utilized the preprocessed TCGA Pan-cancer methylation matrix (Illumina Human Methylation 450k array data) from Carrot-Zhang et al.21 Using the sample-TCGA cancer type mapping information derived from Sanchez-Vega et al.34 ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...