Labshake search
Citations for Illumina :
951 - 1000 of 1461 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: The 3’ adapters were ligated according to the TruSeq kit (Illumina) manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lexogen’s QuantSeq 3’mRNA-seq Library Prep Kit (FWD for Illumina) was utilized for building RNA-seq libraries from 0.1-200 ng of total RNA in 5 µl of nuclease-free ultrapure water ...
-
bioRxiv - Cancer Biology 2024Quote: ... and base calling using the Real-Time Analysis 3 software (Illumina). Demultiplexing and fastq file generation were performed using bcl2fastq v2.20.0.422 software (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and quantified by KAPA qPCR before sequencing on a single lane of a NovaSeq 6000 S4 flow cell (Illumina) to an average depth of 100,000 reads per cell.
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were quantified and qualified using a qPCR quantification protocol guide (KAPA Library Quantification Kits for Illumina Sequencing platforms) and TapeStation D1000 ScreenTape (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control v3 (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Immunology 2021Quote: ... The pooled libraries were quantified by qPCR and sequenced on a NextSeq 500 platform (Illumina, San Diego, CA, USA) with 2x 150 cycles.
-
bioRxiv - Cancer Biology 2021Quote: ... The final library was quantified using qPCR and pooled for sequencing on the Illumina® platform (Illumina, California, USA) with a read length configuration of 150 PE for up to 6M PE reads (3M in each direction) ...
-
bioRxiv - Microbiology 2022Quote: ... and libraries were quantitated with qPCR (Bio-rad CFX96 Touch Real-Time PCR, NEB Library Quant Kit for Illumina). Libraries were normalized to 0.5 nM and pooled ...
-
bioRxiv - Microbiology 2024Quote: ... Library yields were assessed using Agilent Tapestation and quantified via qPCR (KAPA Library Quantification Kits for Illumina platforms, KK4828) on a CFX96 Touch Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Genomics 2020Quote: ... The methylation array used an Infinium Human methylationEPIC BeadChip (Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: RPF were depleted of ribosomal RNA with the Ribo-zero Human kit (Illumina) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2020Quote: ... and analysed using the Infinium Human Methylation 450K BeadChips (Illumina, San Diego, CA) according to the manufacturer’s protocol.
-
bioRxiv - Genomics 2021Quote: We downloaded publicly-available Hi-C data from human prefrontal cortex tissue23,24 (Illumina HiSeq 2000 paired-end raw sequence reads ...
-
bioRxiv - Genetics 2020Quote: ... or the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... ribosomal RNA was removed using the Ribo-Zero Human/Mouse/Rat kit (Illumina). Sequencing libraries were generated according to the TruSeq stranded total RNA (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... SNP genotyping was performed with the HumaHap650Y_V3 or Human 1M-Duo_V3 BeadChips (Illumina) according to manufacturer’s instruction as previously described [48] ...
-
bioRxiv - Genomics 2023Quote: ... Methylation was assessed using the Infinium Human Methylation 450K Bead Chip (Illumina, Inc). A total of 865918 CpGs were present in the dataset ...
-
bioRxiv - Immunology 2021Quote: ... and 200 pg of material was used to generate final sequencing libraries with the NexteraXT kit and NexteraXT Indexing primers (Illumina, Inc) using 12 cycles of PCR amplification ...
-
bioRxiv - Microbiology 2020Quote: ... The forward and reverse primers were designed to contain an Illumina® overhang adapter sequence (Illumina®; San Diego, CA, USA) in order to anneal them to primers containing the Illumina® adaptors plus the 8 bp identifier indices ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified tagmented DNA was amplified with KAPA HIFI polymerase (12 PCR cycles) and Unique Dual Primers from Illumina (Cat number 20332088). Size-selection (L:1.1 ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... and 8.8 µl of paired i7 and i5 Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001) were added to each Tagmentation reaction ...
-
bioRxiv - Immunology 2021Quote: ... Transposed DNA fragments were purified using Qiagen Mini- Elute Kit and PCR amplified using NEB Next High Fidelity 2x PCR master mix (New England Labs) with dual indexes primers (Illumina Nextera). Genomic Alignment of sequencing reads ...
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712) as follows:
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712). The sequences for the primer sets were used for the libraries cloned into pRDA-052 or pRDA-550 are listed below:
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Biochemistry 2024Quote: As template a T7 promoter-containing oligonucleotide was annealed to an equimolar quantity of RBNS T7 template oligonucleotide (a random 20-mer flanked by partial Illumina primers). 500 fmol template were transcribed overnight at 37°C with 200 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified tagmented DNA was amplified with KAPA HIFI polymerase (12 PCR cycles) and Unique Dual Primers from Illumina (Cat number 20332088). Size-selection (L:1.1 ...
-
bioRxiv - Genomics 2022Quote: ... These products were then used for index PCR using the SI-PCR Primer from the 10X kit for the i5 and one of the small RNA TrueSeq index primers for the i7 (Illumina #15004197).
-
bioRxiv - Genomics 2022Quote: ... After purifying the Sample Tag PCR1 product indexing PCR was done following instructions of the MULTI-seq protocol where small RNA TrueSeq indexing primers (Illumina #15004197) were used for i7 and the Forward Primer from the BD WTA kit was used for i5.
-
bioRxiv - Genetics 2022Quote: ... and hMT-2_R (GGCAGGTCAATTTCACTGGT)] and the library preparation of the LR-PCR products of hMT1 and hMT2 primers was conducted using DNA Prep Tagmentation (Illumina Inc.). This approach allows the fragment size of the tagmented LR-PCR products to be evenly 300 bp ...
-
bioRxiv - Plant Biology 2024Quote: ... and combined amplicon pools were used for library preparation following the locus-specific primers protocol from the 16S metagenomic sequencing library preparation guide for the Miseq system (Illumina, 2013). Sequencing of libraries was performed on a MiSeq platform (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... the pool of plasmids for each library (inputs) was amplified using primers bearing sequences from Illumina (Read 1 and Read 2) and complementary to PT1 and down to Moe (Figure 1C) ...
-
bioRxiv - Genomics 2024Quote: ... according to the manufacturer’s protocol.This DNA was then amplified with barcoded primers for Illumina sequencing (NEBNext® Multiplex Oligos for Illumina® #E7335S). PCR amplifications were carried out as [98 °C 30 s ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR for Tm-shift primer method was performed in Quantification / DNA binding Dye / Standard curve mode of an Eco real-time PCR system (Illumina Inc.). The PCR conditions were 94°C for 3 min ...
-
bioRxiv - Microbiology 2024Quote: RNA from turbinate samples were sequenced in duplicate by reverse-transcription and amplification using the IDT-Swift Biosciences SARS-CoV-2 assay with v2 primers and sequenced on an Illumina NextSeq 2000 (Illumina, Inc). Reads were processed and inoculum consensus genome was generated with TAYLOR (https://github.com/greninger-lab/covid_swift_pipeline) ...
-
bioRxiv - Neuroscience 2021Quote: ... Library pool was quantified on Bioanalyzer and with qPCR and sequenced using one NextSeq 500/550 High Output Kit v2.5 (Illumina, 20024907) on Illumina NextSeq500 using these parameters ...
-
bioRxiv - Genetics 2020Quote: ... ChIP-seq and ATAC-seq libraries were quantified by RT-qPCR with the KAPA Library Quantification Complete Kit (KAPA) prior to sequencing on the NextSeq platform (Illumina) with 39 bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... cDNA and barcode libraries were checked for quality on an Agilent 4200 TapeStation, quantified by KAPA qPCR, and sequenced on a single lane (95% transcriptome, 5% barcode) on Novaseq6000 (Illumina) to an average depth of 100,000 reads per cell.
-
bioRxiv - Plant Biology 2020Quote: ... The concentration of the pool of libraries were confirmed using the Qubit and qPCR and then loaded onto an Illlumina NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina; 20024906), to generate approximately 5 million 75bp single-end reads per sample.
-
bioRxiv - Microbiology 2020Quote: ... The indexed libraries were quantified by qPCR using the NEBNext Library Quant Kit for Illumia (NEB, mixed and sequenced on a MiSeq instrument (Illumina)) with a 2×250 paired-end setup.
-
bioRxiv - Cancer Biology 2020Quote: ... The libraries were quantitated by qPCR and sequenced on one lane for 101 cycles from one end of the fragments on a NovaSeq 6000 (Illumina) using a NovaSeq SP reagent kit and yielded 400 to 500 million single reads per lane ...
-
bioRxiv - Cell Biology 2021Quote: ... The libraries were quantified by RT-qPCR and sequenced in paired-end mode (2x75 bp) with NextSeq 500 (Illumina, CA).
-
bioRxiv - Plant Biology 2022Quote: ... were pooled in equimolar amounts, quantified using qPCR and sequenced (paired-end, 2 × 250 cycles) on the NovaSeq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Final quality control by qPCR was performed by the sequencing provider before paired-end 150 nt sequencing on a NovaSeq6000 S4 (Illumina). The sequencing results exceeded 312Gbp ...
-
bioRxiv - Cancer Biology 2022Quote: ... The libraries were quantified by qPCR and sequenced in paired-end mode (2×75 bp) with NextSeq 500 (Illumina, CA). For each sample generated by the Illumina platform ...
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...