Labshake search
Citations for Illumina :
651 - 700 of 1461 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 7.8 and 15.2 kb) were prepared using Illumina TruSeq DNA LT Sample Prep Kits and Nextera Mate Pair Sample Preparation Kits (Illumina Inc., San Diego, CA, USA), following the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2021Quote: ... and pooled libraries of 20 barcoded samples were sent for pair-end sequencing using an Illumina HiSeqTM 2500 sequencing platform (Illumina Inc., San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... The constructed libraries were sequenced as pair-end reads (with a 301-bp read length) on the Illumina MiSeq system (Illumina, San Diego, CA, United States). The strain B50 genome (accession no. ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... USA) for library preparation and 150 base pair (bp) paired-end whole-genome sequencing on an Illumina NovaSeq 6000 (Illumina Inc., San Diego, CA, USA).
-
bioRxiv - Genomics 2021Quote: BD Infinium Human Methylation 450 arrays (Illumina) were retrieved from the European Genome-phenome Archive (EGA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was done with Illumina NextSeq 500 using NextSeq 500/550 High Output Kit v2.5 for HeLa samples and with Illumina NovaSeq 6000 using partial S4 flow cell lane for patient samples.
-
bioRxiv - Neuroscience 2022Quote: ... A Human OmniExpress v1.2 BeadChip array (Illumina) was used post-editing to check for any gross karyotype abnormalities ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was performed at the Institute for Molecular Medicine Finland FIMM Genomics unit with Illumina NovaSeq 6000 using partial S4 flow cell lane ...
-
bioRxiv - Genomics 2021Quote: ... Library was quantified by qPCR and sequenced on a NextSeq 500 (Illumina). FASTQ files were processed using the same pipeline as described above.
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was conducted using Eco Real-Time PCR (Illumina, CA, USA). The PCR mixture included 10 µl 2× Realtime PCR mix (Biofact ...
-
bioRxiv - Biochemistry 2021Quote: ... Libraries were quantified using qPCR (Kapa Library Quantification Kit for Illumina, Roche), and purified with AMPure beads (Beckman Coulter) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms).
-
bioRxiv - Microbiology 2021Quote: ... The short-read sequencing data were obtained from the Norwegian Veterinary Institute Sequencing unit (SEQ-TECH, VI) (Nextera Flex library prep protocol, Illumina MiSeq 300 bp pair-end sequencing). The long-read data were obtained from Nanopore MinION platform (SQK-RAD004 library prep protocol) ...
-
bioRxiv - Microbiology 2020Quote: ... WGS libraries were sequenced with paired-end 150 base pair reads on an Illumina NovaSeq 6000 by the UW Biotechnology Center (Illumina NovaSeq 6000 S1 Reagent Kit v1.5).
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 9-cycle PCR was performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... raw sequence data were filtered for contaminants (E. coli, PhiX, Illumina adaptors or primers) and low quality reads using bowtie2_db (Langmead & Salzberg ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 uL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina, Cambridge, UK)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 uL of 25 μM reverse primer (Nextera/Illumina i7 adaptors (Illumina, Cambridge, UK)) and 25μl NEBNext® Ultra™ II Q5 Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 uL of 25 μM reverse primer (Nextera/Illumina i7 adaptors (Illumina, Cambridge, UK)) and 25μl NEBNext® Ultra™ II Q5 Master Mix (NEB ...
-
bioRxiv - Genetics 2020Quote: ... reverse transcription was performed with Reverse Transcription Primer (RTP) (Illumina sequence, ordered via IDT) and SuperScript IV Reverse Transcriptase (ThermoFisher #18090050) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Double-stranded cap-trapped cDNAs were amplified using a Nextera XT index primer (Illumina), then size selected at 200–400 bp using AMPure beads (BeckmanCoulter) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Eluted DNA was amplified with PCR using Nextera i7- and i5-index primers (Illumina). Purification and size selection of the amplified DNA were carried out with AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... beads and multiplexed by using ScriptSeq Index PCR Primers (Epicentre, Illumina, Madison, WI USA). cDNA libraries were quantified by using KAPA Illumina Library Quantification kit (KAPA Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 uL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina, Cambridge, UK)) ...
-
bioRxiv - Genetics 2022Quote: ... The primers sequences were modified to include Illumina Nextera index PCR adaptor sequences (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of each primer tagged with Nextera XT adapter (Illumina, San Diego, USA) and 1ul of DNA template ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2022Quote: ... both the SNP STARRseq samples were PCR-amplified with TruSeq dual indexing primers (Illumina) to generate Illumina compatible libraries ...
-
bioRxiv - Developmental Biology 2020Quote: ... Eluted DNA was amplified with PCR using Nextera i7- and i5-index primers (Illumina) and purified with AMPure XP magnetic beads (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were designed based upon sequences obtained from the sequenced transcriptome (Illumina) of D ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of forward and 1 μl of reverse 25 μM PCR primers (Illumina), and 0.5 μl of Phusion high-fidelity DNA polymerase (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each P5 and P7 primer (Nextera Index Kit, Illumina, CA, USA), 2 μl of initial PCR product ...
-
bioRxiv - Immunology 2024Quote: ... The products were then purified and enriched by PCR using paired-end primers (Illumina) for 15 cycles to create the final cDNA library ...
-
bioRxiv - Genetics 2023Quote: ... five forward and five reverse primers contain Nextera transposase adapter sequences (Illumina Document#1000000002694) “TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG” (read 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Genomics 2023Quote: ... PCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1, E7335) and amplified to linear phase ...
-
bioRxiv - Developmental Biology 2023Quote: ... sequencing libraries were constructed by adding Illumina P5 and P7 primers (Illumina, Evry, France), as well as sample index via end repair ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of isolated genomic DNA sample and 100 nmol of each primer (WISH_Illumina_fwd and WISH_Illumina_rev ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of isolated genomic DNA sample and 100 nmol of each primer (WISH_Illumina_fwd and WISH_Illumina_rev ...
-
bioRxiv - Neuroscience 2024Quote: ... The library was amplified using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). Two replicate libraries were prepared as described and sent for paired-end sequencing (75bp ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were validated following the Library Quantitative PCR (qPCR) Quantification Guide (Illumina). Paired-end sequencing was performed on the Illumina NextSeq 500 Sequencing System using NextSeq High Output (2 x 150 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were quantified using by qPCR and sequenced on the NextSeq 500 (Illumina) for 25 million reads per plate.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The libraries were validated following the Library Quantitative PCR (qPCR) Quantification Guide (Illumina). Following ...
-
bioRxiv - Microbiology 2022Quote: ... The cleaned library was quantitated using qPCR (NEBNext Library Quant Kit for Illumina), then pooled with PhiX ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...