Labshake search
Citations for Illumina :
6651 - 6700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Library pools were further diluted to 20pM using HT-1 (Illumina) before being diluted to a final loading concentration of 14pM ...
-
bioRxiv - Immunology 2023Quote: ... 25 million reads per sample was performed using a HiSeq2500 (Illumina) on a Rapid run flow cell using a 100 base pairs ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were generated using the Nextera XT DNA library prep kit (Illumina). 25 million reads per sample was performed using a HiSeq2500 (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... to generate libraries for scRNA-seq and sequenced using the HiSeq 4000 System (Illumina). Each library was down sampled to equivalent sequencing depth and libraries were merged with cellranger aggr v2.0.2 pipeline (10X Genomics) ...
-
bioRxiv - Evolutionary Biology 2023Quote: Output files from Illumina MiSeq were first run through FastQC (Andrews et al ...
-
bioRxiv - Biochemistry 2023Quote: ... and HiSeq SR Cluster Kit v4 (Illumina GD-401-4001) on a HiSeq 2500 instrument (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: ... on a HiSeq 2500 instrument (Illumina) in a single 50-base read with custom primer CTTAGCTCCCAGCGACCTGCTTCAATGTCGGATAGTG and 8-base index read 32 using custom primer CTGATGGAGGTAGAAGCCGCAGTGAGCATGGT (Supplementary Fig ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA concentration was measured using the Qubit dsDNA BR assay kit and sequenced using a HiSeq SBS v4 50 cycle kit (Illumina FC-401-4002) and HiSeq SR Cluster Kit v4 (Illumina GD-401-4001 ...
-
bioRxiv - Genomics 2023Quote: ... The library was then constructed from 2 μg of the final pool using the TruSeq Stranded mRNAseq Sample Prep Kit (Illumina). The two libraries were multiplexed and sequenced for 2×250 bp reads on one Illumina HiSeq2500 lane ...
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on NextSeq500 sequencers using 75bp paired-end sequencing method (Illumina, San Diego, CA). For transcriptomic analyses ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were generated using TruSeq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75bp paired-end sequencing method (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... following the manufacturer’s protocol (Illumina, USA). Raw sequencing reads were filtered by Illumina HiSeq Control Software to generate Pass-Filter reads for further analysis ...
-
bioRxiv - Microbiology 2023Quote: ... Raw sequencing reads were filtered by Illumina HiSeq Control Software to generate Pass-Filter reads for further analysis ...
-
bioRxiv - Plant Biology 2023Quote: ... The preparation of the RNA-Seq library was done using 1,000 ng of total RNA according to TruSeq Stranded mRNA (Illumina) Kit and sequenced 2x100 bp paired-end on an Illumina NovaSeq-6000 ...
-
Circadian rhythms in the gut microbiota shape sex differences in host gene expression and metabolismbioRxiv - Systems Biology 2023Quote: Concatenated FASTQ files generated from Illumina were used as input to kallisto111 ...
-
bioRxiv - Systems Biology 2023Quote: ... We extracted sgRNA sequences from Illumina FASTQ files using regular expressions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... barcoded primers flanked by Illumina sequencing adaptors were used to generate the amplicons after 15-20 cycles of PCR for sequencing (Table S6) ...
-
bioRxiv - Genomics 2023Quote: ... The tagmentation and library preparation was performed with the Nextera DNA Library Preparation Kit with 8 cycles of PCR amplification (Illumina #FC-121-1030).
-
bioRxiv - Microbiology 2023Quote: ... DNA was quantified using a Nanodrop spectrophotometer and high-throughput genome sequencing was performed on a MiSeq (Illumina, San Diego, CA, USA), using the Nextera XT Library Preparation Kit with standard protocols involving fragmentation of 2 μg genomic DNA by acoustic shearing to enrich for 600 bp fragments ...
-
bioRxiv - Microbiology 2023Quote: ... Pooled libraries were loaded onto an Illumina MiSeq V3 flow cell (Illumina, United States) and for 2×300 bp paired-end sequencing.
-
bioRxiv - Microbiology 2023Quote: ... UK (Illumina, paired-end ...
-
bioRxiv - Microbiology 2023Quote: ... which was performed using the Nextera XT library preparation kit (Illumina, FC-131-1096, San Diego, California) and then subsequent sequencing on the NovaSeq 6000 platform (1 x 100bp ...
-
bioRxiv - Microbiology 2023Quote: Sequencing libraries were prepared from the same DNA extracted from the individual collected in October 2010 and previously reported in [10] using the Nextera kit (Illumina) according to the manufacturer’s instructions and concentrations measured using the QuantIT kit (Molecular Probes ...
-
bioRxiv - Microbiology 2023Quote: ... EGA10 and EGA65 genomes were sequenced and hybrid assembled at SeqCenter using sequencing data from Illumina (NextSeq 2000, 2×151bp) and Oxford Nanopore platforms ...
-
bioRxiv - Microbiology 2023Quote: ... and tagmented (Illumina Nextera). Transposon-adjacent DNA was then amplified to form Illumina libraries as described [41 ...
-
bioRxiv - Microbiology 2023Quote: ... technology with a Nextseq 500/550 High Output Kit v2 (Illumina) and 75 sequencing cycles (single read ...
-
bioRxiv - Microbiology 2023Quote: RNA sequencing was performed at the high throughout sequencing platform at I2BC (CNRS, Gif-sur-Yvette, France) using Nextseq500 (Illumina) technology with a Nextseq 500/550 High Output Kit v2 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... A genomic library with average insert size of 350 bp was prepared for sequencing using a TruSeq Nano DNA library preparation kit (Illumina, Inc., San Diego, CA, USA). Paired-end 2 x 125 nt sequencing was performed by the MGX platform (CNRS ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced with the NovaSeq6000 (Illumina, San Diego, CA, USA). The sequencing reads were mapped onto the genome of the B ...
-
bioRxiv - Microbiology 2023Quote: ... Paired-end 2 x 125 nt sequencing was performed by the MGX platform (CNRS, Montpellier, France) using a HiSeq 2500 (Illumina), generating 19,127,584 raw read pairs for ABIP441 ...
-
bioRxiv - Systems Biology 2023Quote: ... we downloaded gene expression data (Illumina HT 12, EGAD00010000434) and miRNA expression data (Agilent ncRNA 60k ...
-
bioRxiv - Microbiology 2023Quote: ... No.: FC-131-1096) and were sequenced with the NextSeq 550 instrument (Illumina, USA), using PE mode and a mid-output flow cell (150 cycles) ...
-
bioRxiv - Microbiology 2023Quote: The Acinetobacter isolates libraries were prepared with the Nextera XT DNA Library preparation kit from Illumina (Cat. No.: FC-131-1096) and were sequenced with the NextSeq 550 instrument (Illumina ...
-
bioRxiv - Genomics 2023Quote: Poly-A selected stranded mRNA libraries were constructed from 1 μg total RNA using the Illumina TruSeq Stranded mRNA Sample Prep Kits (Illumina, San Diego, CA) according to manufacturer’s instructions with the following exception ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries for ATAC samples were prepared using the Nextera DNA library preparation kit (Illumina, #FC-121-1030) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The clustering of the index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumina) according to the manufacturer‘s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was column-purified and circularized with CircLigase (Epicentre/Illumina, CL9021K) for 16hrs ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were sequenced paired end on NextSeq500 or NovaSeq6000 instruments (Illumina).
-
bioRxiv - Genomics 2023Quote: ... Paired-end cluster generation of denatured templates was performed according to the manufacturer’s instructions (Illumina, San Diego, CA) utilizing the HiSeq Rapid PE Cluster Kit v2 chemistry and flow cells ...
-
bioRxiv - Genomics 2023Quote: ... Ribosomal RNA was removed with the RiboZero-Gold rRNA removal Kit (Illumina, cat. No MRZG12324). Ribosome protected fragments were size selected from a 15% denaturing urea polyacrylamide gel (PAGE ...
-
bioRxiv - Genomics 2023Quote: ... Sequence read data were processed and converted to short-read FASTQ format by Illumina BaseSpace analysis software (v2.0.13) ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared using the TruSeq Synthetic Long-Read DNA Library Prep Kit (Illumina, Inc; San Diego CA). Three sequencing libraries were prepared by loading the sample into a Covaris g-TUBE (part no ...
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μl of Tagment DNA Buffer (Illumina, FC-131-1096) and incubated at 55°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: ... 12.5 μl of a master mix containing 7.5 μl of Nextera PCR Master Mix (Illumina, FC-131-1096) and 2.5μl of each Index primer i7 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and Nextera XT Index Kit v2 (Illumina, FC-131-2001/2002). 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and Index primer i5 (Illumina, FC-131-2001/2002) was combined with 12.5μl of the tagmented amplicon DNA ...
-
bioRxiv - Genomics 2023Quote: ... A Library Normalization (LN) (Illumina, FC-131-1096) master mix was created by combining the Library Normalization Additives 1 (LNA1 ...
-
bioRxiv - Genomics 2023Quote: ... Library preparation was performed using the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) and Nextera XT Index Kit v2 (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ... were verified by sequencing Nextera XT (Illumina). A pool of all pUC57-tile libraries was made with equal weight per variant ...