Labshake search
Citations for Illumina :
6551 - 6600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... ChIP-seq libraries were prepared using the NEXTflex Rapid DNA-seq kit (Illumina) and sequenced on a Novaseq SP PE50 platform with 2 x 50 bp paired end reads at the CRUK Cambridge Institute Genomics Core facility (Cambridge ...
-
bioRxiv - Developmental Biology 2023Quote: ... Stubby Illumina adapter sequences were added to the forward (ACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexed libraries were pooled and sequenced on an Illumina MiSeq using a MiSeq Reagent Kit v2 (150×150; Illumina) with 10% PhiX spike-in to achieve ∼65,000 aligned reads per library.
-
bioRxiv - Developmental Biology 2023Quote: ... Base calling was done by Illumina RTA3 and output was demultiplexed and converted to FastQ format with Cell Ranger (10X Genomics ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 cycle sequencing kit (v1.5) to a minimum depth of 50K reads per cell (Illumina Inc., San Diego, CA, USA). Base calling was done by Illumina RTA3 and output was demultiplexed and converted to FastQ format with Cell Ranger (10X Genomics ...
-
bioRxiv - Developmental Biology 2023Quote: ... Single clones were expanded and screened by genotyping and MiSeq (Illumina). Knockout clones were validated by western blot.
-
bioRxiv - Developmental Biology 2023Quote: ... rRNA-depleted RNA-seq libraries of 2 biological replicates for wt and Dhx9 KO mESCs were prepared using TruSeq Stranded Total RNA kit (Illumina) and sequenced on an Illumina HiSeq platform to obtain 150-bp paired-end reads ...
-
bioRxiv - Developmental Biology 2023Quote: ... genotyped by PCR (genotyping primer sequences are presented in Table S4) and confirmed by Sanger Sequencing (Quintara Bio) or MiSeq (Illumina). Southern Blot using a CITRINE probe was carried out to verify single integration for the reporter cell lines.
-
bioRxiv - Developmental Biology 2023Quote: ... sequencing libraries were constructed using TruSeq DNA sample Prep Kits (Illumina) and adapter dimers were removed by 2% agarose and Tris-acetate-EDTA gel electrophoresis ...
-
bioRxiv - Developmental Biology 2023Quote: 1000 ng of bisulfite-treated sperm DNA was loaded onto Illumina Infinium Mouse Methylation-12v1-0 BeadChip (llumina) and was ran on an Illumina iScan System (Illumina) per manufacturer’s standard protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Whole genome sequencing libraries were prepared using the TruSeq DNA PCR-Free kit (Illumina) and sequenced on an Illumina HiSeq 4000 instrument according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... a paired-end sequencing library constructed using the TruSeq DNA PCR-Free sample preparation kit (Illumina) with an insert size of 550bp ...
-
bioRxiv - Evolutionary Biology 2023Quote: For the metagenomic libraries we used either TruSeq DNA PCR-free (Illumina) or nano kits (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... “alata” [6] from NCBI Sequence Read Archive (seven 101bp paired-end Illumina libraries ...
-
bioRxiv - Genomics 2023Quote: ... TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, USA) was used as per the manufacturer’s protocol for sequencing library preparation ...
-
bioRxiv - Genomics 2023Quote: ... at IMGM Laboratories GmbH (Martinsried, Germany) using NovaSeq 6000 S1 200 chemistry (Illumina) with paired end reads (2 × 101 bp ...
-
bioRxiv - Genomics 2023Quote: ... this filter step used both germline blood sequencing and standard fidelity (Illumina) tumor sequencing to focus the analysis on low-level mosaic calls.
-
bioRxiv - Genomics 2023Quote: ... variant calls were used in this step from both germline blood sequencing and standard fidelity (Illumina) tumor sequencing to focus the analysis on low-level mosaic calls.
-
bioRxiv - Genomics 2023Quote: ... Libraries were sequenced as paired-end 150×150bp on a NovaSeq® 6000 System (Illumina, Inc.).
-
bioRxiv - Genomics 2023Quote: ... 300 Cycles (Cat. #MS-103-1002; Illumina).
-
bioRxiv - Genomics 2023Quote: ... 300 Cycles (Cat. #MS-103-1002; Illumina), 2×145 bp Illumina-compatible paired-end reads.
-
bioRxiv - Genomics 2023Quote: ... Libraries were sequenced on a MiSeq instrument (Illumina) using the MiSeq reagent Micro kit v2 ...
-
bioRxiv - Genomics 2023Quote: ... libraries were sequenced on a HiSeq4000 instrument (Illumina, USA) with a read length of 150+150 bp ...
-
bioRxiv - Genomics 2023Quote: ... Libraries (2×145 bp Illumina-compatible paired-end reads) were sequenced on a MiSeq® instrument (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Short read libraries were prepared using Nextera XT DNA library preparation kits (Illumina, Inc., San Diego, CA) following the manufacturers protocol ...
-
bioRxiv - Genomics 2023Quote: ... were sequenced on a MiSeq® instrument (Illumina) using the MiSeq reagent Micro kit v2 ...
-
bioRxiv - Genomics 2023Quote: ... using the SP Reagent kit v1.5 300 cycles (Illumina, 20028400), according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... elegans bowtie indexes from assembly WBcel235 (available in Illumina iGenomes webpage; identical to ce11). In addition ...
-
bioRxiv - Genomics 2023Quote: ... multiplexed at even concentration and sequenced on 600 bp (2 × 300bp) pair-end using Illumina MiSeq platform (Illumina, Inc., USA) (EMP 16S Illumina Amplicon Protocol ...
-
bioRxiv - Genomics 2023Quote: ... using the SP Reagent kit v3 300 cycles (Illumina, 20046813), according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: Chloroplastic and mitochondrial genomes of each species were reconstructed from Illumina raw reads using NovoPlasty (Dierckxsens et al ...
-
bioRxiv - Genomics 2023Quote: ... HiC libraries were sequenced on a NextSeq500 instrument (Illumina, USA) with a read length of 150+150 bp ...
-
bioRxiv - Genomics 2023Quote: Nuclei were treated with 2.5 µl of Tn5 Transposase (Illumina) in the standard tagmentation reaction buffer (25 µl) ...
-
bioRxiv - Genomics 2023Quote: Final libraries were sequenced on the NextSeq2000 (Illumina, San Diego, CA, USA) as recommended by 10X Genomics (Read 1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Additional sequencing was performed on a NovaSeq 6000 sequencer (Illumina, San Diego ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... libraries were produced from 50 ng of DNA with the Nextera XT DNA Sample Preparation Kit (Illumina, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... and patient-derived LCLs was used for SNP-array copy number profiling and analysis of regions of homozygosity with the Infinium Human CytoSNP-850K v1.2 BeadChip (Illumina, San Diego, CA, USA). This array has ∼850,000 single nucleotide polymorphisms (SNPs ...
-
bioRxiv - Genetics 2023Quote: ... Strand-specific sequencing libraries were generated using TruSeq stranded total RNA library preparation kit (Illumina Inc. Cat # 20020596) and sequenced as 75bp paired-end reads on an Illumina instrument.
-
bioRxiv - Genomics 2023Quote: ... WGS libraries were generated using standard protocols (Illumina). Libraries were sequenced to 15-30x genome coverage (2×150bp ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and constructed libraries using Illumina TruSeq DNA PCR-Free (Illumina, San Diego, CA, USA) or Illumina DNA Prep ...
-
bioRxiv - Genomics 2023Quote: ... Samples were then loaded onto the Illumina NextSeq500 Instrument using a Mid-output 300 cycle kit (Illumina Catalogue FC-404-2003) or the MinION flow cell ONT instrument (R9.4.1) ...
-
bioRxiv - Genomics 2023Quote: ... and used 1 ng for DNA library preparation using the Nextera XT DNA Library Preparation kit (Illumina), according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... The Nextera HT kit (Illumina) was used to convert cDNA libraries into sequencing libraries with the addition of a UMI-specific primer to amplify the cDNA ends containing molecular barcodes as described in the Smart-seq3 protocol ...
-
bioRxiv - Genomics 2023Quote: Preparation of libraries for SMS for both Illumina (Illumina DNA Prep Kit: 20018704) and ONT (Illumina® DNA Prep ...
-
bioRxiv - Genomics 2023Quote: ... and ONT (Illumina® DNA Prep ...
-
bioRxiv - Genomics 2023Quote: Pelleted nuclei were gently resuspended in a 50 μL transposition reaction mix composed of 25 μL 2× TD Buffer (Illumina), 2.5 μL Tn5 Transposes (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Nextera Library Preparation Biochemistry (Illumina) was used to prepare sequencing libraries ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 μL Tn5 Transposes (Illumina) and 22.5 μL Nuclease-Free H2O ...
-
bioRxiv - Genomics 2023Quote: ... Each individual received a unique barcode before multiplexing individuals (Illumina NovaSeq 6000; 2×150bp PE lane).
-
bioRxiv - Genomics 2023Quote: ... The prepared library was sequenced on Illumina NovaSeq 6000 instrument (Illumina Inc., USA) for paired-end sequencing ...