Labshake search
Citations for Bioline :
351 - 400 of 420 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: RNA was isolated from lung and blood using Isolate II RNA mini kit protocol (Bioline Reagents Ltd., London, UK) with slight modification ...
-
bioRxiv - Immunology 2022Quote: Total mRNA from obtained tissues and RAW 264.7 macrophages was extracted using a RNA extraction kit (ISOLET II RNA Mini Kit, Bioline). cDNA was synthesized from 1 μg of RNA using a PrimeScriptTM RT reagent kit (Lifegene ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was DNA extracted from the sub-samples using the ISOLATE II Genomic DNA Extraction Kit (Bioline, UK) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: RNA was isolated from lung and blood using Isolate II RNA mini kit protocol (Bioline Reagents Ltd., London, UK) with slight modification ...
-
bioRxiv - Microbiology 2020Quote: ... After three washes with ice-cold PBS genomic DNA was isolated using the ISOLATE II Genomic DNA Kit (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The supernatant was harvested for cytokine measurement and the cells were lysed (ISOLATE II RNA Lysis Buffer RLY-Bioline) for RNA extraction.
-
bioRxiv - Plant Biology 2022Quote: ... PCR products were purified from agarose gels using the ISOLATE II PCR and Gel Kit (Bioline, Memphis, TN, USA), and quantified in a NanoDrop One C Spectrophotometer (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2022Quote: ... supplemented with 100 μg/ml ampicillin were processed with either the ISOLATE II Plasmid Mini Kit (Bioline, #BIO-52057) for sequence verification ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was suspended in 100 μl of preheated elution buffer G (ISOLATE II Genomic DNA kit, Bioline Meridian). The DNA quality and quantity was checked by Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Genetics 2023Quote: RNA was isolated from cells with Isolate II RNA Mini Kit according to the manufacturer’s instructions (Bioline, BIO-52702). 1 μg of RNA was converted to cDNA using qScript (Quanta ...
-
bioRxiv - Microbiology 2023Quote: ... and a sample was taken for DNA extraction and purification using an Isolate II Genomic DNA purification kit (Bioline). Also ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR reactions were carried out using 1.25 ng total RNA equivalent RT reaction in sensiFAST SYBR No-Rox mix (Bioline) in presence of 600 nM of each primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR and RT-qPCR were performed according to the manufacturer’s protocols using MyTaq™ Red Mix (Bioline/BIOCAT) for RT-PCR and GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... A CCDC26 exon 6 DNA template was generated by performing a PCR using Red Mix (Bioline, Cat. No. BIO25043) WT K562 cDNA and CCDC26-specific primers that incorporated a T7 RNA polymerase promoter at the 5’-end of the DNA strand to be later transcribed (Supplementary Table 1) ...
-
bioRxiv - Genetics 2022Quote: ... Genotyping was performed directly from the lysates with region targeting primers (Supplementary Table 2) and MyTaq Red Mix (Bioline) followed by gel electrophoresis to reveal biallelic knockout clones ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Systems Biology 2023Quote: ... Each 20 µl RT reaction was amplified in a 100µl PCR reaction with MyTaq Red mix (#BIO-25043; Bioline). The second PCR reaction was performed using 10 µl of the product of the previous reaction in a 100 µl reaction using the same index variant primer and index variants of 437JvA (containing the S1 ...
-
bioRxiv - Cell Biology 2023Quote: ... zona-less E2.5 and E3.5 embryos were placed into 10 µL of DNA lysis buffer (1X MyTaq Red Mix, Bioline, #25044) complemented with 0.2 µL of 10 mg/mL proteinase K (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... For each gene a total of 8 clones from each plant were isolated from overnight LB cultures using an ISOLATE II Plasmid Mini Kit (Bioline) prior to sequencing with universal M13F and M13R primers by GATC Biotech (Konstanz ...
-
bioRxiv - Developmental Biology 2019Quote: ... Embryos were dechorionated and washed with 100% ethanol prior to RNA extraction using the ISOLATE II RNA Mini Kit’s protocol (Bioline, UK). The extracted RNA was quantified using Nanodrop (Thermo Fisher Scientific) ...
-
Genomic and phenotypic characterization of finger millet indicates a complex diversification historybioRxiv - Genetics 2021Quote: ... Genomic DNA (gDNA) was extracted from finely-ground leaf material using the ISOLATE II Genomic DNA Kit (Bioline Pty Ltd) and according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: RNA from GP barley infected with Fg-IFA65 at 5 dpi and an uninfected control was extracted with the Isolate II plant miRNA kit (Bioline). 1 µg of RNA (>200 nt ...
-
bioRxiv - Developmental Biology 2021Quote: ... washed in water and 100% ethanol prior to RNA extraction using the ISOLATE II RNA Mini Kit’s protocol (Bioline, UK). The extracted RNA was quantified using Nanodrop (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The purified PCR product was run on a 1% agarose gel cut out to remove remaining primer dimers and cleaned with PCR Isolate II PCR and Gel Kit (Bioline). The purified libraries were sequenced on an Illumina HiSeq2500 or MiSeq depending on the expected complexity of the library.
-
bioRxiv - Microbiology 2019Quote: ... Samples were ground to a fine powder in liquid nitrogen and total RNA was isolated with the isolate II RNA Mini Kit (Bioline). After DNase treatment (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... and conducted at 100V for 30 min with product size approximated using HyperLadder II 50bp DNA marker (Bioline, Sydney, Australia).
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated from lung homogenates from mice exposed to E-cigarettes (with and without nicotine) and room air (SHAM) using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of the entry vector was also digested with EcoRI-HF and NheI-HF and the linearised product was purified from a 2% agarose gel using PCR Isolate II PCR and Gel Kit (Bioline). The digested and purified reporter pool was then ligated into 80 ng of the linearised entry vector using Takara ligation kit v1.0 (#6021 ...
-
bioRxiv - Plant Biology 2023Quote: ... and the 200 to 400 bp range was purified by gel extraction using Isolate II PCR and Gel Kit (Bioline). Libraries were sequenced (100 bp paired-end ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 ml chloroform was added for phase separation using phase lock gel heavy tubes and RNA isolation from the aqueous phase was obtained by using ISOLATE II RNA Mini Kit (Bioline). RNA quality was verified with Agilent 2100 Bioanalyzer System using RNA Nano Chips (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... If a band was visualised at ∼480 bp the PCR product was purified using an ISOLATE II PCR and Gel Kit (Bioline).
-
bioRxiv - Microbiology 2023Quote: ... PCR products that produced bands of the correct size were purified using the ISOLATE II PCR and Gel Kit (Bioline) as per manufacturer’s protocol and submitted for sequencing using an Applied Biosystems 3730xl capillary analyser (Macrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 ml chloroform was added for phase separation using phase lock gel heavy tubes and RNA isolation from the aqueous phase was obtained by using ISOLATE II RNA Mini Kit (Bioline). RNA quality was verified with Agilent 2100 Bioanalyzer System using RNA Nano Chips (Agilent Technologies) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lyrata PER plants as above and a short section of ASY3 was PCR amplified using 0.5 μM primers (S5 Table) and MyTaq™ Red Mix (Bioline). PCR conditions were as follows ...
-
bioRxiv - Developmental Biology 2020Quote: ... one μg of each template was synthesized into cDNA with a standard reaction mix (SensiFAST™ cDNA Synthesis Kit, Bioline) in a thermal cycler (Bio-Rad T100TM Thermal Cycler ...
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR (qPCR) was carried out using the cDNA generated previously employing the SensiFAST SYBR mix No-Rox Kit (Bioline, UK in a Rotor-Gene 6000 real-time PCR cycler (Corbett Research ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplicons for sequencing were generated by PCR using degenerate primers (see Supplemental Table 1) for each locus using My Taq HS mix (Bioline) and gel purification ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR reactions were performed in 12 μL mixtures containing 1 x SensiFAST SYBR No-ROX mix (Bioline, Australia), 400 nM of each forward and reverse primer (Table 3 ...
-
bioRxiv - Genetics 2019Quote: ... We tested the primers on DNA extracted from the liver of Mongolian gerbil and fat sandrat using the MyTaq Red Mix (Bioline). In each 25ul PCR reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using 5μl cDNA mix and 200nM custom-designed primers (Table 1) and SensiMix (Bioline, London, UK). qPCR data were analysed using ΔCt methods as described previously [Isles et al. ...
-
bioRxiv - Microbiology 2019Quote: ... a total volume of 25μL was prepared as mastermix with 5μL as DNA template and 20μL constituting of My Taq ™ Red Mix (Bioline; UK) 12.5μL ...
-
bioRxiv - Genetics 2021Quote: ... cCREs and promoters were amplified from mouse genomic DNA (extracted fromE14TG2a mESCs, ATCC CRL-1821) by PCR using My-Taq Red mix (#BIO-25044; Bioline) in 384 well plates using automated liquid handling (Hamilton Microlab® STAR) ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR bands were extracted from the agarose gel and purified using and Isolate II PCR and gel kit (Bioline, London, UK) and sent for Sanger sequencing (GATC Biotech ...
-
bioRxiv - Microbiology 2022Quote: ... A few microliters of each PCR product were run on an agarose gel to assess the success of the PCR reaction and the remains cleaned through an Isolate II PCR and Gel kit (Bioline, USA) and sent for sequencing with primer C1-N-2191 ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA (gDNA) was isolated from mouse brains or dural meninges using the Isolate II Genomic DNA Kit (Bioline, BIO-52067) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: DNA was isolated from whole adult BF and HIE-18 cells using an Isolate II Genomic DNA kit (Bioline, NSW, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cells were collected and genomic DNA was extracted using the ISOLATE II Genomic DNA kit (Bioline cat. no. BIO-52067). PCR was performed in two steps and pooled experiments were performed in triplicates for a higher coverage ...
-
bioRxiv - Microbiology 2020Quote: Bacterial cultures were grown in Luria Bertani (LB) broth for 18-24h at 37 °C and DNA was extracted using the Isolate II Genomic DNA Kit (Bioline, UK) according to the manufacturer’s instructions ...