Labshake search
Citations for Bioline :
201 - 250 of 420 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... RNA extraction was performed using the Isolate II RNA Plant kit (Bioline). During RNA extraction two samples were combined by using the same lysis buffer on two samples to make up one biological replicate ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated using an Isolate II Rna Mini Kit (Bioline). 250~500 ng of RNA was reverse transcribed into cDNA using the High-Capacity cDNA reverse transcription kit (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2021Quote: ... total cellular RNA was isolated using the Isolate II RNA kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and purified using the PCR Isolate II PCR and Gel Kit (Bioline) or by ExoSAP (for primers see Table S4) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted using the Isolate II RNA Mini kit (Bioline, UK). 1-3 µg were reverse transcribed with a MuLV reverse transcriptase (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated using an Isolate II RNA Mini Kit (Bioline) directly from the wells as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... genomic DNA was extracted using the ISOLATE II Genomic DNA kit (Bioline). Following DNA amplification and fragmentation according to the associated Illumina HTS assay protocol samples were hybridized to an Infinium PsychArray v1.1 BeadChip (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... then purified by ISOLATE II PCR and Gel Kit (Bioline #BIO-52059) or the Exo-Cip Rapid PCR Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... coli were extracted using the ISOLATE II Plasmid Mini kit (Bioline, Australia) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted using ISOLATE II Plant DNA extraction kit (Bioline, 52070) following manufacturer’s recommendations and CTAB lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was isolated using the ISOLATE II Genomic DNA Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The total RNA was extracted with an Isolate II RNA minikit (Bioline) and analyzed by qRT-PCR with specific primers for ZTA ...
-
bioRxiv - Microbiology 2024Quote: ... genomic DNA was isolated using the ISOLATE II Genomic DNA Kit (Bioline) according to the manufacturer’s instructions ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... For the semi-quantitative end-point PCRs the MyTaq Red Mix (Bioline) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time PCR analysis was carried out using SYBR Green mix (Bioline) in a Bio-Rad CFX-100 RT-qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR was performed in technical duplicates using SensiMix SYBR mix (Bioline). The U6 snRNA gene was used as an internal control.
-
bioRxiv - Zoology 2019Quote: ... PCR solutions for each marker contained 0.5U MyTaq HS Mix polymerase (Bioline), 1 μL of DNA template ...
-
bioRxiv - Genomics 2021Quote: ... The PCR was performed using the MyTaq HS mix (Bioline, BIO-25045) - or the Q5 polymerase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The amplification was performed in 25 µl containing Biomix reaction mix (Bioline) and ultra-stable Taq DNA polymerase (Bioline) ...
-
bioRxiv - Systems Biology 2023Quote: ... 14 PCR cycles were performed using MyTaq Red Mix (#BIO-25043; Bioline), yielding 30 µg of barcodes ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR was performed with 20 µl Mango Mix™ (Bioline, UK), 0.25 µM of each primer and 2 µl of DNA template in a final volume of 40 µl with nuclease free water (Ambion ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1.5 ul of DNA was used in MyTaq™ Red Mix (Bioline) PCR amplification and samples were genotyped using primers from Kobayashi et al ...
-
bioRxiv - Immunology 2021Quote: ... washed with PBS and total RNA extracted (Isolate II RNA mini kit, Bioline). cDNA was synthesized from 1 μg of total RNA using Oligo (dT ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was extracted using the ISOLATE II RNA/DNA/Protein kit (Bioline, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of knockout mutants was isolated using the ISOLATE II kit (Bioline). Genomic DNA was cut using KpnI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA was extracted using the ISOLATE II Genomic DNA Kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was isolated using the Isolate II RNA Mini Kit (Bioline BIO-52072), and 1 μg was converted to cDNA using the qScript cDNA Synthesis Kit (Quantabio) ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was extracted from cultured cells using ISOLATE II RNA Mini Kit (Bioline) and used as a template to generate cDNA with Tetro cDNA Synthesis Kit (Bioline) ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated using Bioline II DNA/RNA/Protein extraction kit (Bioline, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was isolated from cells with Isolate II RNA Mini Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA extraction was performed using the ISOLATE II RNA mini kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA extraction was performed using the ISOLATE II RNA Plant Kit (Bioline, Australia), followed by TURBOTM DNase treatment (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid extraction was performed with ISOLATE II Plasmid Mini Kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: RNA was isolated from cells using the ISOLATE II RNA Mini Kit (Bioline) and concentration was measured by Nanodrop (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: Further RNA purification was performed using the Isolate II RNA Plant Kit (Bioline). Washing ...
-
bioRxiv - Plant Biology 2023Quote: ... and further purified with Isolate II Gel and PCR Clean-up Kit (Bioline). Libraries were then generated from fragmented DNA (Covaris ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR was carried out with SensiFAST(tm) SYBR® & Fluorescein Mix (BIOLINE) in a Bio-Rad iQ5 thermal cycler ...
-
bioRxiv - Genetics 2021Quote: ... and qPCR was performed using SensiFast Sybr Lo-Rox Mix (BIO-94020, Bioline). The run was performed by using the Applied Biosystems (Waltham ...
-
bioRxiv - Microbiology 2019Quote: ... PCR amplification was performed in 25µl volumes with 2Χ Ready-mix (Bioline, UK) (volume 12.5µl ...
-
bioRxiv - Cancer Biology 2019Quote: ... in a HT7900 Real Time PCR System using SensiMix SYBR-Green Mix (Bioline) with standard cycling conditions ...
-
bioRxiv - Zoology 2021Quote: ... PCR amplification was performed using 12.5 µL of MyTaq HS Mix (Bioline, US) hot-start polymerase ...
-
bioRxiv - Genomics 2023Quote: ... 25 μL 2 x MyTaq HS Red Mix (Bioline, cat. no. BIO-25048), and plate-specific Illumina PCR indexed primers (TAC0012 and TAC0007 ...
-
bioRxiv - Immunology 2023Quote: ... Transcript expression was quantified using Sybr green reaction mix SensiFAST (Bioline, #BIO-86005) and 10 pmol of specific primers ...
-
bioRxiv - Microbiology 2023Quote: ... 1.5 µl of sterile water and 7.5 µl SYBR Hi-ROX mix (Bioline). Reaction conditions were as follows ...
-
bioRxiv - Microbiology 2019Quote: ... then total RNA was extracted using the Isolate II RNA mini extraction kit (Bioline), according to the ‘cultured cells and tissue’ protocol in the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids were purified with the BIOLINE ISOLATE II Plasmid Mini Kit (#BIO-52057; Bioline). Before addition to the one-pot restriction-ligation reaction ...
-
bioRxiv - Molecular Biology 2021Quote: ... Resulting PCR products were purified on columns (Isolate II PCR Kit (BIO-52059, Bioline)) that are suitable for >50 bp DNA fragments ...
-
bioRxiv - Molecular Biology 2019Quote: ... All reaction products were purified with the Isolate II PCR kit (Bioline USA, Inc.). These libraries underwent nick translation and amplification ...
-
bioRxiv - Immunology 2021Quote: ... and RNA was extracted using Isolate II RNA Mini or Micro Kit (Bioline, UK). An amount of 5 ng of total RNA per sample was used for transcriptome amplification using NuGEN’s Ovation RNA-Seq V2 kit (San Carlos ...