Labshake search
Citations for Bioline :
51 - 100 of 420 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... We used the 2x SensiFAST Probe No-ROX One-Step Mix (Bioline, Cat No./ID: BIO-76005), according to manufacturer specifications using 2.5 µl RNA template ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 µL SensiFAST(tm) Probe Hi-ROX Kit master mix (Bioline, Tauton, MA), 1.25 µL each of Cx ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using the 2× SYBR Green PCR Master Mix (Bioline) with the CFX96 detection system and analyzed with CFX Manager softward (Bio-rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... Each PCR reaction (20 μL) contained 2X SensiFAST SYBR® No-ROX mix (Bioline, BIO-98005, 10 μL), 10μM primers ...
-
bioRxiv - Biochemistry 2020Quote: ... The resulting cDNA was amplified and quantified using SYBR Green PCR Master Mix (Bioline) in QuantStudio 6 Flex ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR (qPCR) reactions (20 μl) included 1X SensiMix SYBR green master mix (Bioline), 0.5 μM of each primer and 5 μl template cDNA (used at 1:200 dilution in RNase-free water) ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Bioline) with gene-specific primers according to the manufacturer’s protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR reaction volumes are as follows: 12.5 μL MyTaqTM Master Mix (Bioline, United Kingdom), 10 μL molecular-grade water (G-Biosciences ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR analyses were performed using Brilliant III SYBR Green QPCR master mix (Bioline) with gene-specific primers according to the manufacturer’s protocol and the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies) ...
-
bioRxiv - Zoology 2021Quote: ... 2.8μl of water and 5μl of SensiFAST SYBR Lo-ROX master mix (Bioline, London, UK) per reaction.
-
bioRxiv - Microbiology 2021Quote: ... 7 μL of SensiMix™ SYBR® Green Master Mix (Bioline®, Memphis, TE, USA), and H20 in a total volume of 15 μL ...
-
bioRxiv - Neuroscience 2023Quote: Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... IS2404 real-time PCR mixtures contained of 10.0□μl of 2x SensiFast Probe NO-ROX mix (BioLine Cat# BIO-86005), 3.2□μl of nuclease-free water ...
-
bioRxiv - Microbiology 2023Quote: PCR products for the generation of different potential RNase E targets were amplified with MyTaq™ Red Mix 2x (Bioline), and Synechocystis genomic DNA as template (primers T01 to T12) ...
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μL of purified DNA with 10 μL 2x MyTaq HS Mix polymerase (Bioline) and 1 μl (5 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplicon PCR was conducted using 50ng of DNA (or 20ng for samples with lower DNA yield) along with 2x Accuzyme mix (Bioline) to amplify barcodes using the following primer sequences (Forward - ACTGACTGCAGTCTGAGTCTGACAG ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Two μl of diluted cDNA were combined with 5μL SYBR-Green Master mix (Bioline, Luckenwalde, Germany), 0.2 μl of each forward and reverse primer (10 ɥM stock ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative-RT PCR was then performed using the SensiFAST SYBR Green Hi-ROX master mix (Bioline). Primers were designed (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: Target gene real-time qPCR analyses were conducted using SYBR Green Master Mix (Bioline #BIO-98005) with the LightCycler® 480 System (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR or RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Bioline) with gene-specific primers on a Applied Bioscience StepOnePlus qPCR machine (Life Technologies) ...
-
bioRxiv - Plant Biology 2020Quote: ... Table 1) were used in a pre-optimised PCR master mix (BioMix™, Bioline, Meridian Bioscience; Australia) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... was performed on a Qiagen Rotor-Gene Q 2plex real-time PCR cycler with 2x SensiFAST™ SYBR No-ROX mix (Bioline, #98020). Phosphoglycerate kinase 1 (Pgk1 ...
-
bioRxiv - Genomics 2020Quote: ... Realtime RT-PCR was carried out on an Applied Biosystems 7900HT using SensiMix SYBR green master mix (Bioline). 300nM each primer were added to 10μl reactions in 384-well plates ...
-
bioRxiv - Microbiology 2022Quote: ... Each sample contained 2μl of boiled cell solution and 18μl of the PCR master mix with MyTaq DNA Polymerase (Bioline). The PCR cycling conditions were 95 ᵒC 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplifications were carried-out in total volume of 10 µL containing 1x SensiFast master mix (Bioline, Meridian Bioscience), 0.5 μM of each primer set (dhfr-F/R and 529rpe-F/R) ...
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μl of purified DNA with 10 μl 2x MyTaq HS Mix polymerase (Bioline, Narellan, NSW, Australia) and 1 μl (5 μM ...
-
bioRxiv - Developmental Biology 2023Quote: ... which is GC-rich and required MyTaq (Bioline #BIO-21105). The amplification ran for 30 cycles (Fig S1A ...
-
bioRxiv - Immunology 2020Quote: ... A 2X Taq-based mastermix (Bioline) was used for all reactions and run on a CFX384 Real-Time System (Bio-Rad) ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 μl 2X BioMix Red (Bioline) and ddH2O ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR was done using gene-specific primers (see Supplemental Table 1) in technical triplicates on a LightCycler 480 system using the Sensifast SYBR Master mix (Bioline). The ratio of experimental target mRNA to an ACTIN control for each sample was calculated by Applied Biosystems software ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We labeled each library with a sample-specific pair of barcodes and combined libraries in equimolar ratios based on qPCR using SensiFAST SYBR Hi-ROX master mix (Bioline), then sequenced the combined pools on four lanes of 50bp single end reads (Illumina HiSeq2500 ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were generated in 25 µl reactions containing 12.5 µl Bioline PCR Master Mix (Bioline USA Inc, Taunton, MA), 10.0 µl MG H2O ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was done using gene-specific primers in technical triplicates on a LightCycler 480 system using the Sensifast SYBR Master mix (Bioline). The ratio of experimental target mRNA to Actin control for each sample was calculated by Applied Biosystems software ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplification was performed in a total reaction mixture of 10 μL containing 1x SensiFast master mix (Bioline, Meridian Bioscience), 0.5 μM of reverse and forward primers ...
-
bioRxiv - Microbiology 2021Quote: ... Each reaction (20 μL) consisted of 1 μL of cDNA substrate and 19 μL of a SensiFAST No-ROX Kit Master Mix (Bioline, UK). Following primer optimisation ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1 μL of the obtained cDNA was used for real-time PCR with SYBR™ green master mix (Bioline, Luckenwalde, Germany) on a C1000 Touch™ Thermal Cycler (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... For the PCR master mix (MM) MangoTaq DNA polymerase and MyTaq DNA Polymerase were used and all PCR reagents were from Bioline (London, UK). To reduce the PCR inhibitors 0.4 μg μL−1 of bovine serum albumin (BSA ...
-
bioRxiv - Genomics 2023Quote: ... Samples were prepared for qPCR in technical duplicates in 10-μl reaction volumes using SensiFAST SYBR Lo-ROX 2× Master Mix (Bioline, BIO-94005), custom qPCR primers from Integrated DNA Technologies used at a final concentration of 0.2 μM and cDNA diluted at 1:20 by volume ...
-
bioRxiv - Cell Biology 2020Quote: ... SensiMix II (Bioline) was added to samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... was amplified in 10 μL reactions containing 2x SensiMix (Bioline) and 1 μM of forward and reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... SensiMix™ SYBR® & Fluorescein (2X) reagent (Bioline, QT615-05) was used for all RT-PCR reactions ...
-
bioRxiv - Microbiology 2019Quote: ... containing 50 μl of 2x PCR BioMix™ (Bioline, London, UK), 1 ul (5 pmol ...
-
bioRxiv - Microbiology 2019Quote: ... containing 50 μl of 2x PCR BioMix™ (Bioline, London, UK), 5 pmol of both forward and reverse primers ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5 μl of 2X SensiFAST SYBR No-ROX kit (Bioline) in a 10 μl total volume ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed using 2x SensiFAST SYBR No-ROX kit (Bioline) in 20 µl reactions using 1µl of RT reaction as input and 0.4µM each primer.
-
bioRxiv - Neuroscience 2021Quote: ... 1mM dNTP Mix (Bioline), 40 units of Ribosafe RNAse Inhibitor (Bioline) ...
-
bioRxiv - Molecular Biology 2023Quote: ... a dUTP mix (Bioline), containing dATP ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1mM dNTP Mix (Bioline), 40 units of Ribosafe RNAse Inhibitor (Bioline) ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR was performed as described (24) using 2x SensiFast mastermix (Bioline) with primers and probes to a final concentration in 25uL reaction volume of 0.32uM (primers ...
-
bioRxiv - Cell Biology 2019Quote: ... qPCR reactions were set up using SensiMix 2x Mastermix (Bioline Cat# QT615-20) and oligonucleotides targeting genes of interest (IDT ...