Labshake search
Citations for Millipore Sigma :
151 - 200 of 2250 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 2x 100% methyl salicylate (Sigma-Aldrich) 30 min each at RT protected from light ...
-
bioRxiv - Cancer Biology 2022Quote: ... incubated in 2x SSC buffer (Sigma) at 60°C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... 2x Antibiotic-Antimycotic (A5955, Sigma Aldrich), 1 mM sodium pyruvate (S8636 ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL of sample was injected into the GC (Sigma-Aldrich 5973 Network mass selective detector attached to an Agilent 6890 gas chromatograph (Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: T3 (T2877) and GC-1 (SML1900) were purchased from Sigma-Aldrich. MGL-3196 ...
-
bioRxiv - Neuroscience 2022Quote: ... GCS and MCS were purchased from Sigma Aldrich (Saint-Louis, USA) and the CaCl2 and MgCl2 from Fluka (distributed by VWR ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and nicotine free base (>99% GC) were purchased from Sigma-Aldrich and used as the components of the e-liquid ...
-
bioRxiv - Biochemistry 2023Quote: ... and NO-GC activator cinaciguat hydrochloride (10 μM) (SML1532, Sigma Aldrich), [1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ ...
-
bioRxiv - Cancer Biology 2023Quote: ... MSTFA and GC-MS grade solvents were purchased from Sigma-Aldrich. LC-MS grade water and acetonitrile were purchased from Fischer Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 2x 100%) and infiltrated in a graded series of Durcupan (25%, 50%, 75%, 90%, 2x 100%, Sigma) and polymerized in the oven at 60°C for 96 h.
-
bioRxiv - Molecular Biology 2020Quote: ... Real time quantitative PCR was performed with KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich - Merck, UK, cat no KK4602) according to manufacturer’s instructions in a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet of 1 mL lysed with Bug Buster (pellet sample) (Bug Buster® Master Mix, Novagen® Merck). For lysis ...
-
bioRxiv - Immunology 2022Quote: ... Each panel was prepared as a single-test master mix in total 100µL with 100mM D-(+)-Trehalose dehydrate (Sigma-Aldrich) and 0.1X cell staining medium (CSM ...
-
bioRxiv - Physiology 2019Quote: ... for synthesizing the probes was amplified using the primers described in Table S3 as following: the PCR reaction was set with KOD hot start master mix (#71842, Novagen), according to the manufacturer’s instructions and subsequently purified (#28706 ...
-
bioRxiv - Microbiology 2023Quote: ... gene was PCR amplified from individual spores with primers AML225 (GAACCCAAACACTTTGGTTTCC) and WANDA26 (CAGCCGCGGTAATTCCAGCT) using JumpStart RedTaq DNA Polymerase Master Mix (Sigma). PCR products were sent for cleaning and Sanger sequencing (Macrogen Europe) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized using the SuperScript IV VILO Master Mix and oligo (dT)20primers (Sigma-Aldrich, St. Louis, MO, USA). Quantitative reverse transcriptase PCR (qRT-PCR ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were sorted into wells containing 1μL of master mix (0.2% n-dodecyl-beta-maltoside (D4641-500MG, Sigma Aldrich, Germany), 100mM tetraethylammonium bicarbonate (17902-500ML ...
-
bioRxiv - Neuroscience 2022Quote: ... Muscle tissues were minced into small pieces with scissors and added to a 50mL conical tube with 1mL of enzyme mix (500 U/mL type II collagenase [MP biomed], 1.5U/mL Collagenase D [Sigma] 2.5U/mL Dispase II [Sigma] ...
-
bioRxiv - Cell Biology 2019Quote: ... a 2x stock of 20nM fMLP (Sigma) was added ...
-
bioRxiv - Cell Biology 2019Quote: ... Large volumes of 2x YT media (Sigma) inoculated with overnight grown bacterial culture was grown at 370C till absorbance A600 reaches ∼0.6 and induced with 100 µM IPTG for 4 hours at 220C ...
-
bioRxiv - Microbiology 2019Quote: ... and 2x antibiotic antimycotics (A5955, Millipore Sigma). The agar overlays were allowed to solidify for 30 minutes at room temperature and incubated at 37°C until plaques were clearly visible ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2x phosphatase inhibitor cocktail (# P2850, Sigma), 2 mM MgCl2 and 25U/ml Benzonase (# 70746 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 2x 100% Aceton (Sigma-Aldrich #179124). After embedding in Durcupan resin (Sigma-Aldrich #44611 and #44612) ...
-
bioRxiv - Bioengineering 2022Quote: 2x 10 mL syringes (Sigma-Aldrich: Z683604)
-
bioRxiv - Molecular Biology 2022Quote: ... cOmplete Mini protease cocktail (2x, Millipore Sigma). Lysate samples were analyzed by BCA kit ...
-
bioRxiv - Neuroscience 2023Quote: ... into 2x SSC Buffer (Sigma-Aldrich, #AM9770) containing hybridization capture probe at 25 nM ...
-
bioRxiv - Neuroscience 2023Quote: ... into 2x SSC Buffer (Sigma-Aldrich, #AM9770) containing hybridization probes at 25 nM and recombinant proteinase K enzyme (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2x protease inhibitor cocktail (1 Sigma protease inhibitor tablet per 50 mL of buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 2X complete protease inhibitor tablet (5056489001, Sigma)) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2X complete protease inhibitor tablet (5056489001, Sigma)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 500 µL 2x BES solution (Sigma, 14280) was added dropwise to the tube walls with rotation ...
-
bioRxiv - Developmental Biology 2021Quote: ... The qPCR reaction was performed on a qTOWER3 real-time thermal cycler (Analytik Jena) with KAPA SYBR FAST master mix (Sigma-Aldrich). Gene expression was monitored using gene-specific primers ...
-
bioRxiv - Immunology 2023Quote: ... Samples were incubated overnight in a humidity chamber at 4 °C in the primary antibody master mix diluted in TBS with 1% BSA (Sigma Aldrich). Slides were washed twice in 0.1% TWEEN20 (Sigma Aldrich ...
-
bioRxiv - Biophysics 2023Quote: ... TAG and cysteine mutations were introduced using oligonucleotide- based mutagenesis with KOD Hot Start Master Mix according to manufacturer’s instructions (Merk Millipore; Burlington, MA). All sequences were confirmed with DNA sequencing (ACGT DNA Sequencing Services ...
-
bioRxiv - Biophysics 2022Quote: ... DMSO (dimethyl sulfoxide, BioUltra 99.5% GC-41639, Sigma-Merck, KGaA, Darmstadt, Germany) and ethanol (puriss ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were reconstituted in 100 μL hexane (GC grade, Sigma Aldrich, USA). GC-MS analysis was performed using an Agilent 8860 GC system equipped with an Agilent 7683 N auto sampler and a Agilent J & W GC columns (30 m × 0.25 mm × 0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... The DRGs were enzymatically dissociated by incubation with digestion mix containing F12 with 3mg/mL dispase II (Sigma Aldrich, #04942078001), 12.5 mg/mL collagenase type IA (Sigma Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... Post-hybridization cell pellets were washed in wash buffer twice, then washed in 2X SSC before being resuspended in anti-fade buffer (2X SSC, 0.4% glucose (Sigma), Tris-HCL pH 8.0 (USB Corporation ...
-
bioRxiv - Microbiology 2021Quote: ... A PCR master mix was prepared by combining the following reagent volumes per sample: 15 µl of Platinum PCR Supermix UDG (Sigma Aldrich, USA), 0.25 µl each of Forward and Reverse Primers (10 µM ...
-
bioRxiv - Bioengineering 2019Quote: ... 1.842 mL of a prepolymer master mix was prepared by combining 942 µL polyethylene glycol diacrylate 700 (PEG-DA; Sigma-Aldrich 455008), 724 µL Milli-Q water ...
-
bioRxiv - Genomics 2021Quote: ... Reactions per sample were pooled and library concentration was quantified via qPCR using the KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich, KK4602). UMI-4C libraries were pooled and sequenced on an Illumina HiSeq or NovaSeq (paired-end ...
-
bioRxiv - Molecular Biology 2023Quote: ... The locus with expected insertion was amplified by PCR using 5 μL KOD Hot Start 2× Master Mix (Sigma Aldrich 71842-3), 0.2 μL each primer at 10 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... and the proteins were then eluted by heating the beads for 5 min at 95 °C in 50 μl of 2x SDS buffer (Laemmli 2x ref S3401-1VL, Sigma), Finally ...
-
bioRxiv - Bioengineering 2022Quote: ... Tissues were digested for 60 minutes at 37°C in an enzymatic mix composed of type II collagenase (10 mg/ml; C6885, Sigma Aldrich) and elastase (1 mg/ml ...
-
bioRxiv - Immunology 2023Quote: ... GC B cells were permeabilized and blocked with 0.25% Triton X100 (Sigma-Aldrich) 2% Fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... GC-B cells and follicle B cells were stained with Pna-HRP (Sigma) and anti-mouse IgD-BIOT (SouthernBiotech ...
-
bioRxiv - Immunology 2019Quote: ... Equal volumes of 2X Laemmli buffer (Sigma-Aldrich) were added to each sample and analyzed by immunoblotting ...
-
bioRxiv - Neuroscience 2022Quote: ... in 2X Sodium Sodium-Citrate buffer (SSC, Sigma) for Mouse 448 and human experiments or 1 mg/ml Hoechst (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... and resuspended in 2X Laemmli sample buffer (Sigma). Samples were then incubated at 95°C for 5 minutes and stored at -80°C until western blot analysis.
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 2x protease inhibitor cocktail set (Millipore)) ...