Labshake search
Citations for Millipore Sigma :
1 - 50 of 2250 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... KAPA SYBR® Fast qPCR Master Mix (2x) Kit (Sigma), was used ...
-
bioRxiv - Immunology 2024Quote: ... KAPA SYBR FAST qPCR Master Mix (2X) (Millipore Sigma; KK4600) and a QuantStudio 7 Pro qPCR (Applied Biosystems ...
-
STAT3 protects HSCs from intrinsic interferon signaling and loss of long-term blood-forming activitybioRxiv - Immunology 2023Quote: ... using 2X SYBR Select Master Mix (Sigma-Aldrich, St. Louis, MO) and gene-specific primers (Table S5) ...
-
bioRxiv - Microbiology 2021Quote: ... A PCR master mix was prepared using 10 µL KAPA SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich, Gillingham, UK), 0.4 µL ROX High ...
-
bioRxiv - Genetics 2022Quote: ... and KAPA SYBR FAST qPCR Master Mix (2X) Kit (Sigma-Aldrich, USA). RT-qPCR primers for the FLO1 gene were 5′-CGCCGATCACATCAACGAACT-3′ and 5′-ACCCCATGGCTTGATACCGTC-3′ ...
-
bioRxiv - Microbiology 2023Quote: ... and 25µL 2x KOD Hot Start Master Mix (Sigma-Aldrich, Cat. No. 71842). Cycling conditions ...
-
bioRxiv - Immunology 2023Quote: ... and 25 µL 2x KOD Hot Start Master Mix (Sigma-Aldrich, Cat. No. 71842). Cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 10 μl of KAPA SYBR FAST qPCR Master Mix (2X) ABI Prism (Sigma-Aldrich), which contains a Taq DNA polymerase that lacks proofreading activity ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μL 1 μM primer (equal mix of Forward and Reverse primers; Table S2) and 5 μL 2x SYBR Green master mix (Sigma) in a 384-well plate using a Roche LightCycler 480 with the following parameters ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR reaction mixture consisted of Kappa Probe Fast qPCR Master Mix (2X) Kit (Sigma-Aldrich), 0.75 μL of primers and 2.5 μL of RNA in a final volume of 10 μL reaction ...
-
bioRxiv - Genetics 2024Quote: ... RT-qPCR was performed using KAPA SYBR® FAST qPCR Master Mix (2X) Universal (Sigma-Aldrich) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative PCR mixtures (10 μL) contained 5 μL Kapa SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich), 300 nM of the primer pair ...
-
bioRxiv - Immunology 2021Quote: ... was performed in QuantStudio 5 384 Optical well plate system (Applied Biosystem) in a standard 10 ul with the 2X SYBR FAST qPCR Master Mix (Sigma-Aldrich) with gene specific primers (Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 22 µL sample was mixed with 25 µL 2x KAPA 2G robust HS Master Mix (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany), 1.5 µL 10 µM Index 1 primer and 1.5 µL 10 µM Index 2 primer ...
-
bioRxiv - Microbiology 2020Quote: ... Cyber Green master mix (Sigma Aldrich) was used for both qPCR and nl-qPCR however there was 1.8-fold more DNA in nl-qPCR reactions ...
-
bioRxiv - Genetics 2019Quote: Quantitative amplification was performed according to manufacturer’s specifications using KAPA SYBR® FAST qPCR Kit Master Mix (2X) Universal (Sigma, cat. #07959397001). 12 separate RNA isolations were analyzed ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Real-Time PCR reactions were performed in 20 µL mixtures containing 10 µL KAPA SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich, KK4605), 200 nM final concentration of species-specific rpoD forward and reverse primer and up to 3 µL of sample template ...
-
bioRxiv - Microbiology 2020Quote: ... Novagen Bugbuster Master Mix (Novagen, Merck, USA) and three additives (NaOH ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in BugBuster Master Mix (EMD Millipore) (volume ...
-
bioRxiv - Systems Biology 2023Quote: ... 70 µl BugBuster master mix (EMD Millipore) was added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... The procedure for primary GC culture was as follows: GCs of pre-hierarchical SWF follicles were digested by 0.25 % type II collagenase (Sigma-Aldrich, St. Louis, MO, USA) in a 37 °C water bath for approximately 3 min ...
-
bioRxiv - Microbiology 2019Quote: ... 2X Luminoct SYBR Green qPCR ready mix (Sigma-Aldrich, Dorset, UK), 25ng of cDNA and PCR grade water (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative Real-time PCR reactions were performed on a Bio-Rad CFX96 Termo-cycler with Kapa Syber Fast qPCR master mix (2x) kit (Sigma-Aldrich, Saint Louis, MO, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and LuminoCT Taqman Master Mix (#L6669; Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and KOD Hot Start Master Mix (Millipore Sigma). Amplicons from clone #8 were sent to Massachusetts General Hospital Center for Computational and Integrative Biology DNA Core for Complete Amplicon Sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... lysed in 300 µL Bugbuster Master Mix (Millipore), and clarified before analyzing supernatants by absorption and fluorescence spectroscopy in a Tecan 20M plate reader ...
-
bioRxiv - Systems Biology 2019Quote: ... Identification of metabolites from organic phase GC-MS analysis was supported by comparison with a FAME standard mix (Supelco 37 Component FAME Mix; Sigma Aldrich).
-
bioRxiv - Microbiology 2019Quote: ... with the universal primers NL1 (GCATCAATAAGCGGGAGGAAAG) and NL4 (GGTCCGTGTTTCAAGGGG. A master mix solution was prepared containing 25 µl of KOD (Hot start Master Mix-Sigma Aldrich), 1.5 µl of each primer and 18.5 µl of NFW ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2x cell wall digestion enzyme mix B stock (0.4% Driselase (SIGMA, D8037) and 0.3% Macerozyme R-10 (RPI ...
-
bioRxiv - Biophysics 2020Quote: ... VDAC1 proteins were extracted with BugBuster Master Mix (Novagen) and purified with Ni-NTA His·Bind Resins (Novagen) ...
-
bioRxiv - Genetics 2023Quote: ... and SYBR green master mix kit (Sigma, Aldrich, Germany) respectively according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... GC (Sigma-Aldrich), Urea (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... Fragments were amplified using a high-fidelity polymerase mix (KOD Hot Start Master Mix, Millipore) and purified on a 1% agarose gel ...
-
bioRxiv - Physiology 2021Quote: ... FastStart Universal SYBR Green Master Mix (4913850001) was from Millipore-Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... For genotyping PCR JumpStart RedTaq PCR master mix (Sigma-Aldrich) was used following the manufacturer’s protocol for cycling with an annealing temperature of 55°C and 35 cycles.
-
bioRxiv - Plant Biology 2021Quote: ... Proteins were extracted with the BugBuster ® Master Mix (Novagen), according to manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 µl KAPA SYBR FAST 2× Master Mix (Sigma-Aldrich) and 2 µl Milli-Q water ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Protein was extracted using BugBuster Master Mix (Sigma Aldrich, 71456), mixed 1:1 with 2x laemmli sample buffer (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... We used KOD Hot Start Master Mix (EMD Millipore, 71842) to perform all PCRs ...
-
bioRxiv - Microbiology 2020Quote: ... was added to 24 μl of reaction mix containing 12.5 μl of 2x Sybr Green Jumpstart Taq Ready-mix (Sigma Aldrich), 0.125 μl of each of the primers PRK341F and MPRK806R (Table S2) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and genotyping was performed with NovaTaq Hot Start Master Mix (Millipore) according to the manufacturer’s cycling parameters (Tm=55°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCR reactions were performed using SYBR Green Master Mix (Sigma L6544) and primers for pyruvate carboxylase (Forward ...
-
bioRxiv - Synthetic Biology 2021Quote: ... then mixed with 3.75 mL of BugBuster® master mix (Novagen) for 20 minutes at room temperature ...
-
bioRxiv - Plant Biology 2023Quote: ... Induced cell pellets were lysed in BugBuster® Master Mix (Novagen) with cOmplete™ the EDTA-free Protease Inhibitor Cocktail (Roche) ...
-
DeCOIL: Optimization of Degenerate Codon Libraries for Machine Learning-Assisted Protein EngineeringbioRxiv - Bioengineering 2023Quote: ... A reaction master mix composed of 625 μM indole (Sigma 13408) and 25 mM serine (Sigma S4500 ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were lysed using BugBuster Master Mix solution (Millipore Sigma #71456) and then inclusion bodies were isolated ...
-
bioRxiv - Genomics 2023Quote: ... This mix was added dropwise in 200 μl of 2X HEPES buffered saline (51558; Sigma) with gentle agitation on a vortex mixer to form calcium phosphate-DNA precipitate ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.76 µL master mix 1 (1 µL 5x Superscript II reaction buffer [ThermoFisher], 1 µL 5 M betaine [Sigma-Aldrich], 0.25 µL 100 mM dithiothreitol (DTT), 0.035 µL 1 M magnesium chloride [ThermoFisher] ...
-
bioRxiv - Bioengineering 2020Quote: ... DMSO (GC grade; Sigma-Aldrich) was then added and the absorbance (570–630 nm ...
-
bioRxiv - Microbiology 2019Quote: ... the cells were harvested and digested with Bugbuster Master Mix (Merck Millipore). The mixture was then centrifuged at 15,000 g at 4 °C and the supernatant was filtered with a 0.22 μm filter (Merck Millipore) ...