Labshake search
Citations for Millipore Sigma :
101 - 150 of 2250 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... PCR reactions were run under standard conditions using KOD Hot Start Master Mix (Sigma-Aldrich: 71842). After subsequent ligation with T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR analysis was performed using the KAPA SYBR Fast PCR master mix (Sigma Aldrich, #KK4605) or SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... using the SYBR™ Green master mix (life technologies) and predesigned primers (KiCqStart® Primers, Sigma). Relative gene expression levels were normalized to β-actin in each sample with the ΔΔCT method.
-
bioRxiv - Microbiology 2020Quote: ... A region of pol (44, 45) was amplified using KOD Hot Start Master Mix (Millipore, 71842) in a first round of PCR with forward primer ...
-
bioRxiv - Systems Biology 2020Quote: ... 4μl of a master mix containing 2.5μl of 1M triethylammonium bicarbonate (TEAB, Millipore Sigma T7408-100ML), 1.3μl of 200ng/μl trypsin (Promega Trypsin Gold ...
-
bioRxiv - Cancer Biology 2021Quote: ... The antibody master-mix was then filtered through a pre-wetted 0.1-μm spin-column (Millipore) to remove antibody aggregates ...
-
bioRxiv - Microbiology 2022Quote: ... Eighty µl of a master reagent mix (20 µl bicine buffer (1M, pH 8, Sigma-Aldrich), 10 µl H2O ...
-
bioRxiv - Plant Biology 2023Quote: ... The total of 10 mL master mix solution was made of 10 µL of Luminol (Sigma) from 100 mM stock solution in DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... Each 20 µl PCR reaction contained 10 µl of JumpStart RedTaq DNA Polymerase Master Mix (Sigma), 8 µl dH2O ...
-
bioRxiv - Synthetic Biology 2023Quote: ... KAPA SYBR FAST polymerase master mix was purchased from Sigma-Aldrich (St. Louis, MI, United States).
-
bioRxiv - Pathology 2019Quote: ... 2X SSC (Sigma, S6639)) ...
-
bioRxiv - Neuroscience 2019Quote: ... Laemmli 2x concentrate (Sigma) was added to each lysate and boiled for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... Laemmli 2x concentrate (Sigma) has been used as a sample buffer for reducing and loading protein samples in SDS-PAGE ...
-
bioRxiv - Cancer Biology 2020Quote: ... Genomic regions containing guide sequences are PCR amplified using paired primers with 25 uL 2x JumpStart Taq Polymerase Ready Mix (Sigma-Aldrich), 1.5 uL 10 uM primer pair (CropSeq_NGS_P7 ...
-
bioRxiv - Genomics 2020Quote: ... The plate was heated at 65° C for 5 minutes and transferred to ice prior to the addition of 1 ul of 2X Reverse transcription mix (15% PEG 8000 [Sigma Aldrich] ...
-
bioRxiv - Bioengineering 2021Quote: ... and the cell pellets were lysed in 200 µL of Bugbuster Master Mix (Merk Millipore, Damstadt, Germany). After centrifugation ...
-
bioRxiv - Biochemistry 2022Quote: ... after which inclusion bodies were isolated from the pellet according to manufacturer’s protocol (BugBuster Master Mix, Novagen). Purified IBs containing BbHtrA were resuspended in Denaturing/Binding buffer (20 mM phosphate buffer ...
-
bioRxiv - Bioengineering 2019Quote: ... Cells were pelleted again before lysis with using 5 mL BugBuster® Master Mix (EMD Millipore, USA) for each gram of cells ...
-
bioRxiv - Physiology 2022Quote: ... Amplification of 300 ng of DNA was performed using KOD Hot Start Master Mix (Sigma-Aldrich 71842), forward and reverse primers of the mutations (USP8 Forward ...
-
bioRxiv - Developmental Biology 2023Quote: ... marinus genomic DNA (gDNA) or st18-st26 embryonic cDNA using KOD Hot Start Master Mix (Millipore Sigma) with primers listed above ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed using either KAPA HIFI 2X ready mix (KAPA Biosystem, cat# KK2602) or Expand Long Template PCR System (Sigma, cat# 11681842001). Primers used for each PCR reaction are listed in Table S4.
-
bioRxiv - Microbiology 2021Quote: ... Laemmli 2X Concentrate (Sigma Aldrich) and boiled at 95°C for ten min to elute the bound proteins ...
-
bioRxiv - Microbiology 2021Quote: ... 2x protein inhibitor complex (Sigma) in PBS was added and protein levels were normalized by Bradford assay ...
-
bioRxiv - Genetics 2022Quote: ... 2X HEPES Buffered Saline (Sigma) and four lentiviral component plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... Laemmli 2X Concentrate (Sigma Aldrich) and boiled at 95° for ten minutes to elute the bound proteins ...
-
bioRxiv - Cancer Biology 2022Quote: ... EmbryoMax Nucleosides 100X (Millipore, 2X) and N-acetyl glucosamine (GlcNAc ...
-
bioRxiv - Genomics 2019Quote: ... #AM9342)/ 2X SSC (Sigma-Aldrich, #S6639) for 2.5 mins ...
-
bioRxiv - Neuroscience 2022Quote: ... 2X HEPES Buffered Saline (Sigma) and four lentiviral component plasmids ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2x Pen/Strep (Sigma) and 2x Amphotericin B (Life Tech) ...
-
bioRxiv - Cell Biology 2021Quote: ... and Sox2 cDNA were amplified by real-time qPCR using a SYBR PCR Master Mix Kit (Sigma-Aldrich) and a 7500 Real-Time PCR Detection System (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... Cell-surface antibody master-mix in CSM was filtered through a pre-wetted 0.1 μm spin-column (Millipore) to remove antibody aggregates and added to the samples ...
-
bioRxiv - Developmental Biology 2019Quote: The +2.0drl regulatory element was amplified from the zebrafish vector +2.0drl:EGFP by PCR using KOD Hot Start Master Mix (Novagen) (Table S1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and this sequence was amplified by PCR from 3’ RACE cDNA using KOD Hot Start Master Mix (Novagen) with the following primers ...
-
bioRxiv - Developmental Biology 2019Quote: ... marinus genomic DNA or from stl8-26 embryonic cDNA by PCR using KOD Hot Start Master Mix (Novagen). 3’ rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was performed in triplicates with the KAPA SYBR® Fast qPCR Master mix (Sigma-Aldrich, KK4600) using a Rotor-Gene Q (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: Viral barcodes were amplified in 50 µl PCR reactions using KOD Hot-Start Master Mix (Sigma-Aldrich, 71842). For the viral supernatant samples ...
-
bioRxiv - Genetics 2023Quote: ... Ligation master mix was set up at room temperature and 5.2 μL added per well (ligation master mix = 1.63 μL 50% PEG 8000, 0.97 μL 1,3 propanediol (Millipore 807481), 0.75 μL SCR Buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... The phosphatase inhibitor mix consisted of a 1:100 dilution of Phosphatase inhibitor cocktail II (Sigma, USA), 25 mM NaF ...
-
bioRxiv - Neuroscience 2019Quote: ... We added 3 μl instead of 4 μl of master mix containing only 1.7 μl instead of 2.7 μl of 1 M Trehalose (Sigma-Aldrich) directly to the 2 μl cell lysate without a SPRI bead cleanup step ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Microbiology 2021Quote: ... the cell suspensions were spun at 10,000 x g for 10 minutes and bacterial pellets were lysed by addition of BugBuster Master Mix (Merck Millipore) for 25 minutes at room temperature with gentle agitation ...
-
bioRxiv - Microbiology 2021Quote: ... spun at 10,000 x g for 10 minutes and bacterial pellets lysed by addition of BugBuster Master Mix (Merck Millipore) for 25 minutes at room temperature with gentle agitation ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PRC using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Microbiology 2020Quote: ... using First strand cDNA synthesis kit (Fermentas K1612) qPCR was performed using Fast Start Universal Master mix (ROX) (Sigma) using exon spanning primers:-IL17A_Fp TGGAATCTCCACCGCAATGA ...
-
bioRxiv - Microbiology 2019Quote: ... a pellet corresponding to a 250 ml culture was resuspended in 1.5 ml of BugBuster Master Mix (MD Millipore) supplemented with 50 μl of DNAse I (5mg/ml) ...
-
bioRxiv - Microbiology 2023Quote: ... The cell suspensions were centrifuged at 10,000 x g for 10 minutes and bacterial pellets were lysed by addition of BugBuster Master Mix (Merck Millipore) for 25 minutes at room temperature with gentle agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA corresponding to the fxn gene was amplified using KOD hot start master mix (Cat. N° 71842 Millipore) and FwDdFXNOE and RevDdFXNOE as primers (Table 1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... incubated in 2x SSC buffer (Sigma) at 60°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laemmli 2x Concentrate (Sigma-Aldrich, S3401) and heated to 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... incubated in 2x SSC buffer (Sigma) at 60°C for 1 hour ...