Labshake search
Citations for Millipore Sigma :
4801 - 4850 of 5994 citations for Rat TNF alpha ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... using First strand cDNA synthesis kit (Fermentas K1612) qPCR was performed using Fast Start Universal Master mix (ROX) (Sigma) using exon spanning primers:-IL17A_Fp TGGAATCTCCACCGCAATGA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptotic cells were identified by TUNEL assay on sections using an ApopTag in situ apoptosis detection kit (Merck-Millipore).
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were stained for SA-β-galactosidase activity overnight using a Cellular Senescence Assay kit (Merck Millipore, Massachusetts, USA) and imaged the next day in the motorised widefield microscope Cell Observer (Zeiss ...
-
bioRxiv - Cancer Biology 2020Quote: Protein co-localization was assessed via proximity ligation assay (PLA) using the Duolink In Situ Red Starter Kit (Sigma) and PLA-approved primary antibodies for SC-35 (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell counting and viability were performed Muse® Count & Viability Assay Kit in a Muse Cell Analyser (Merck Millipore).
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were fixed by 4% PFA and stained with warm TRAP staining solution (TRAP kit, Sigma-Aldrich, SLBW4002) for 10-30 min at 37°C27 ...
-
bioRxiv - Cell Biology 2021Quote: ... The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA immunoprecipitation (RIP) assays were performed using Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (EMD Millipore 17-700). HEK293T cells were plated on 15-cm dishes coated with poly-L-ornithine at a density of 4E4 cells/cm2 ...
-
bioRxiv - Cell Biology 2022Quote: ... ligation and amplification steps were all carried out according to manufacturer’s protocol (DuoLink PLA assay kit, #DUO92008, Sigma Aldrich). Primary antibodies used were rabbit anti-BAF (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... The membrane was hybridized with a digoxigenin-labeled DNA probe generated with a PCR DIG Probe Synthesis Kit (Sigma). Hybridization with a 5’ probe produced an 8.1 Kb band from the WT and a 5.1 Kb band from the targeted locus ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... DNA was purified from cells harvested at the indicated time points using a Mammalian Genomic DNA Miniprep Kit (Sigma). DNA was immobilized on nitrocellulose and analyzed by immunodot blotting with antibodies against cyclobutane pyrimidine dimers (CPDs ...
-
bioRxiv - Microbiology 2022Quote: The PCR products were inserted into the pET-30 Ek/LIC vector according to manufacturer’s instructions (LIC Kit, Novagen) (Table S2) ...
-
bioRxiv - Immunology 2022Quote: ... Genomic DNA was extracted from PBMCs using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, USA).
-
bioRxiv - Developmental Biology 2022Quote: The concentration of triglycerides in Drosophila larvae was measured using the Triglyceride Quantification Colorimetric Kit from Sigma (Cat. # MAK266). Ten ...
-
bioRxiv - Cancer Biology 2022Quote: The viability of THP-1 cells was assessed for 24h using the Cell Proliferation Kit II (XTT) (Sigma-Aldrich) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from sub-cultured isolates (loop of colonies) using the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Changes in the ADP/ATP ratio were measured using the ADP/ATP ratio assay kit purchased from Sigma-Aldrich which is based on a luciferin - luciferase assay ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was crosslinked using UV light and hybridized with a DIG labelled probe (PCR DIG probe synthesis kit, Sigma). For detection of LbuCas13a the membrane was stripped and probed with DIG labelled Cas13a specific probe and signal detected on a Licor Odyssey imaging system (LI-COR Bioscience ...
-
bioRxiv - Molecular Biology 2021Quote: Boyden chamber transwell migration assays were set-up according to the cell migration assay kit manufacturer’s instructions (Sigma #ECM507), with RAW264.7 macrophages seeded in the upper chamber (30,000 per chamber ...
-
bioRxiv - Microbiology 2021Quote: ... YFP-dsRNA was labeled using the fluorescein RNA Labeling Mix Kit following the manufacturer’s instructions (Sigma, St. Louis, MO). For confocal microscopy examination of fluorescent dsRNA uptake by fungal mycelium ...
-
bioRxiv - Immunology 2020Quote: ... Plasmids encoding the selected peptides were isolated in 96-well format using the Montage Plasmid MiniprepHTS Kit (MilliPore, LSKP09604) on a MultiscreenHTS Vacuum Manifold (MilliPore ...
-
bioRxiv - Neuroscience 2021Quote: ... Cytokines/chemokines were then quantified by multiplex immunoassay using a high sensitivity mouse multiplex magnetic bead kit (Millipore Sigma) and performed according to the manufacturer’s recommendations (MILLIPLEX MAP Mouse Cytokine/Chemokine Magnetic Bead Panel-Immunology Multiplex Assay ...
-
bioRxiv - Biochemistry 2020Quote: ... fixed and stained for β-galactosidase activity at pH = 6 using Senescence Cells Histochemical Staining Kit (Sigma, Cat#CS0030). For rescue assays ...
-
bioRxiv - Cell Biology 2021Quote: VCAM-1 in the media (1:100) from MCECs stimulated with MG was measured using commercial kits from Sigma, according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... Free fatty acids were measured by a colorimetric assay using the Free fatty acid quantification Kit (Sigma-Aldrich, #MAK044) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: Apoptotic cells in the lung were detected by immunohistochemistry using the ApopTag in situ apoptosis detection kit (EMD Millipore) following the manufacturer’s directions ...
-
bioRxiv - Biochemistry 2021Quote: ... Pluripotency status of control and ABCF1-knockdown cells were analyzed using an alkaline phosphatase (AP) detection kit (EMD Millipore), or by RT-qPCR analysis of mRNAs purified using TRIzol reagent (Life Technologies).
-
bioRxiv - Immunology 2021Quote: ... and growth factors were quantified in plasma using a 23-plex MAP NHP immunoassay kit (PCYTMG-40K-PX30, Millipore) following the manufacturer’s recommendations ...
-
bioRxiv - Pathology 2022Quote: ... The PLA was conducted according to the manufacturer’s instructions using the Duolink In Situ Red Starter Kit Mouse/Rabbit (Cat. No. DUO92101, SIGMA). After blocking for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... TUNEL Assay detecting apoptotic cell death were performed with the ApopTag Fluorescein in situ apoptosis detection kit (S7110, Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Cell Counting Kit-8 (CA1210) and D-Luciferin (L6882) were all purchased from Sigma-Aldrich (Saint Louis, MO, USA). Lipofectamine2000 was purchased from Invitrogen (11668019 ...
-
bioRxiv - Immunology 2022Quote: RNA extraction of freshly isolated cells in BAL or detached AMs was performed using total RNA purification kit (Sigma) together with DNase I (invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: The ATPase activity of βγ-CAT was measured by an ATPase activity assay kit (Sigma-Aldrich, Cat MAK113-1KT) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The protein supernatants were collected after centrifugation at 30,000g at 4 °C for 30 min and then quantified using a 2D-quant kit (Sigma). For each diagnostic group ...
-
bioRxiv - Genetics 2019Quote: ... 50 uL of PCR product of each sample was purified with SpinPrep PCR Clean-Up Kit (EMD Millipore Corp) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... the recovered nuclear pellet was extracted as for broccoli nuclei using Nuclear Extraction Buffer (CelLytic PN kit, Sigma-Aldrich).
-
bioRxiv - Neuroscience 2019Quote: ... Samples of medium were collected after 3h and analyzed with a colorimetric glutamate assay kit (Sigma-Aldrich; MAK004-1KT), according to the manufacturer‘s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Further staining of primary antibody was performed following Dako envision plus kit and DAB staining (Anti-ITGA2, Sigma HPA063556). Hematoxolin and eosin staining was performed following dehydration of the tissue by incubation with increasing concentrations of alcohol ...
-
bioRxiv - Genetics 2019Quote: ... the tagmented DNA was amplified by PCR using the KAPA2G Robust PCR kit (Sigma-Aldrich, St. Louis, MO, USA) using the GC buffer along with 0.2 μM of each custom P5 and P7 indexing primers (File S1 ...
-
bioRxiv - Biochemistry 2019Quote: The medium of stimulated 3T3-L1 adipocytes was collected and glycerol content measured using a standard glycerol kit (Sigma). Cells were washed three times with 1xPBS and lysed by incubation with 0.3 M NaOH and 1% SDS ...
-
bioRxiv - Microbiology 2019Quote: ... each RNA sample was supplemented with 1 unit of DNase I (from the DNA amplification grade Kit of Sigma) per µg of RNA and incubated at room temperature for 10 min ...
-
bioRxiv - Pathology 2020Quote: ... Adiponectin was measured in the samples using MILLIPLEX Mouse Cytokine/Chemokine 1-plex kit (Millipore, St. Charles, MO, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... 200 μL of incubation media was removed and kept to measure glycerol and FA release using commercial kits (Sigma-F6428 and Wako diagnostic NEFA-HR ...
-
Potential of host serum protein biosignatures in the diagnosis of tuberculous meningitis in childrenbioRxiv - Immunology 2019Quote: All biomarkers were evaluated following the instructions of the respective kit manufacturers (R&D Systems and Merck Millipore, respectively) in a blinded manner ...
-
bioRxiv - Neuroscience 2019Quote: DNA from offspring was extracted from mouse ear punches using Extract-N-Amp® kit (Sigma, St. Louis, MO) and genotyped using a multiplex PCR reaction ...
-
bioRxiv - Biochemistry 2019Quote: ... the levels were measured using the Single Molecule Counting (SMC®) Immunoassay Technology using commercially available kits from Millipore / Sigma (Aβ1-40 ...
-
bioRxiv - Developmental Biology 2020Quote: Genomic DNA extractions were performed with Extract-N-Amp or REDExtract-N-Amp™ Tissue PCR Kits (Sigma-Aldrich). Whole embryos or adult zebrafish fin-clips were lysed by incubation in a mixture of 50 μL extraction solution (Extraction Solution E7526 ...
-
bioRxiv - Zoology 2020Quote: PCR amplification of two genomic regions were performed using 12.5 μl of the Extract-N-AmpTM Tissue PCR kit (Sigma), 1 μl of each primer ...
-
bioRxiv - Cancer Biology 2019Quote: ... The proximity ligation assay was performed using a Duolink In Situ Red Starter Kit Mouse/Rabbit (Sigma-Aldrich DUO92101). The cells were blocked with a solution provided by the kit and then incubated overnight at 4°C in a 1:500 dilution of primary antibodies for p53 and Parkin ...
-
bioRxiv - Cell Biology 2020Quote: Mitochondria were freshly isolated from IECs of Smyd5fl/fl and Smyd5ΔIEC mice as described before 20 using a mitochondria isolation kit (MITOISO1, Sigma) according to the manufacturer’s instruction.