Labshake search
Citations for Millipore Sigma :
4601 - 4650 of 5994 citations for Rat TNF alpha ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Genotyping to determine p53-/- mice was performed with the REDExtract-N-AMP Tissue PCR Kit (Sigma XNAT-100RXN). Ear punches were digested according to the kit protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Intracellular transglutaminase activity was determined using a Transglutaminase Assay Kit (Sigma-Aldrich, catalog number CS1070, St. Louis, MO) using 20μg total protein per the manufacturer’s instructions ...
-
bioRxiv - Zoology 2021Quote: ... Amplified PCR products were gel-extracted and purified with the Illustra Exo ProStar kit (Sigma Aldrich, Madrid, Spain) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was resuspended in 20 μL water and digested with DNaseI using amplification grade AMPD1 kit (Sigma-Aldrich) prior to reverse transcription ...
-
bioRxiv - Biochemistry 2021Quote: Triphosphatase activity of SaTTM was analysed with the Malachite Green Phosphate Assay Kit (MAK307-1KT) from Sigma Aldrich according to manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... Glycerol concentration was measured as per the manufactures protocol using the free glycerol determination kit (Sigma-Aldrich, #FG0100).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from the frozen leaves using the Spectrum™ Plant Total RNA Extraction Kit (Sigma). Silica-dried leaves of two species (Stewartia malacodendron and Laplacea fruticosa ...
-
bioRxiv - Biochemistry 2019Quote: G3P and DHAP were measured using fluorimetric and colorimetric kits available from Sigma-Aldrich (MAK207 and MAK275, respectively). After differentiation in 6-well plates ...
-
bioRxiv - Microbiology 2019Quote: ... Determination of D-2HG concentration was assayed with a D-2-Hydroxyglutarate (D-2HG) Assay Kit (Sigma MAK320).
-
bioRxiv - Microbiology 2020Quote: ... Pellets were processed according to the B protocol of the NXTRACT kit (CelLytic™ NuCLEAR™ Sigma-Aldrich, Milan ...
-
bioRxiv - Molecular Biology 2019Quote: Paraffin-embedded sections were stained with either a Periodic acid Schiff (PAS) staining kit (Sigma-Aldrich, United States), a Trichrome (Masson ...
-
bioRxiv - Genomics 2021Quote: Plasma leptin concentration was assayed using a multispecies leptin RIA kit (Cat#XL-85K, Millipore, Billerica, Massachusetts, USA). The validity test for reindeer showed a linear correlation between the label and sample concentration ...
-
bioRxiv - Microbiology 2020Quote: Oxidized proteins containing carbonyl groups were detected using the OxyBlot Protein Oxidation Detection Kit (Sigma-Aldrich: cat#S7150). Briefly ...
-
bioRxiv - Cell Biology 2019Quote: ... The quantity of triglyceride (TG) in the cells was calculated using a serum TG determination kit (Sigma-Aldrich). To measure alkaline phosphatase (ALP ...
-
bioRxiv - Physiology 2021Quote: ... Glycogen content was measured using the same kit following an 8 h amyloglucosidase (A9228, Sigma-Aldrich Canada Co.) digestion in a dark drawer at room temperature ...
-
bioRxiv - Physiology 2021Quote: ATP content was determined by using ATP Bioluminescent Assay Kit (FL-AA; Sigma-Aldrich, Saint Louis, MO, USA) according to the manufacturer’s procedure ...
-
bioRxiv - Physiology 2020Quote: ... Glycerol and free-fatty acids were measured using commercial kits Free Glycerol Reagent (Sigma, USA; Cat. No: F6428) and Half-micro test (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... TRAP staining of osteoclasts was performed on day 6 using a leukocyte acid phosphatase kit (Sigma-Aldrich; #387A). TRAP+ multinucleated cells were scored as mature osteoclasts and quantified ...
-
bioRxiv - Cell Biology 2020Quote: ... All cell lines were tested to be free of mycoplasma contamination using a mycoplasma PCR detection kit (Sigma). Cell lines were authenticated using short tandem repeat (STR ...
-
bioRxiv - Biochemistry 2021Quote: ... The pTriEx-4 Ek/LIC hTG4 vector was constructed using pTriEx™-4 Ek/LIC Vector Kit (Novagen) based on the manufacturer instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... The extraction of nuclear proteins has been performed using the CelLytic™ NuCLEAR™ Extraction kit (Sigma-Aldrich) complemented with PIC ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cell cultures were routinely checked for mycoplasma using the LookOut® Mycoplasma PCR Detection Kit (Sigma Aldrich, #D9307).
-
bioRxiv - Cell Biology 2021Quote: Serum glycerol and true triglyceride (TG) levels were determined using a Serum Triglyceride Determination Kit (Sigma-Aldrich TR0100). In brief ...
-
bioRxiv - Immunology 2021Quote: ... Multi-analytic profiling beads using Milliplex® Multiplex mouse cytokine/chemokine panel I kit (EMD Millipore, Billerica, MA) according to manufacturer’s instructions were used to analyze chemokines and cytokines profile into BM and LN tissues at different time periods after LPS or PBS administration into WT mice.
-
bioRxiv - Neuroscience 2021Quote: Total NADP and NADPH in hippocampal homogenates were measured colorimetrically using NADP/NADPH Quantitation kit (Sigma-Aldrich, USA) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Cells were lysed and RNA extracted with the GenElute™ Mammalian RNA Extraction Kit (cat. RTN70, Sigma-Aldrich) and reverse transcribed into cDNA using SuperScript® III First-Strand Synthesis SuperMix (cat ...
-
bioRxiv - Immunology 2020Quote: ... total RNA was isolated from xenograft tissue using the GeneElute Mammalian Total RNA Miniprep Kit (Sigma, Rehovot, Israel) combined with on-Column DNase I Digestion Set (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... Multiplex immunoassays were carried out following the manufacturer’s instructions (Milliplex ® Map kits. EMD Millipore Corporation, Livingston UK). Data were analysed using either one-way ANOVA or Kruskal-Wallis test depending on the homogeneity of variance (tested by Bartlett’s test) ...
-
bioRxiv - Microbiology 2020Quote: Nuclear and cytoplasmic extracts were prepared from differentiated THP-1 cells using Nuclei EZ Prep kit (Sigma-NUC101) both from un-stimulated and MprA stimulated cells ...
-
bioRxiv - Molecular Biology 2021Quote: Detection of apoptotic cells was determined by using ApopTag® Fluorescein In Situ Apoptosis Detection Kit (Sigma Aldrich). Paraffin sections were deparaffinized and hydrated as described and then treated with proteinase K (20 μg/mL ...
-
bioRxiv - Physiology 2020Quote: ... Subcellular fractions were extracted using differential lysis and solubilization with a commercial Millipore Compartmental Protein Extraction Kit (Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Arginase activity was analyzed on Plasma using the Arginase Activity Assay Kit (MAK112, Sigma-Aldrich, St. Louis, MO) following the manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: Cells were crosslinked with 1% formaldehyde for 10min before chromatin fragmentation with EZ-enzyme kit 17-375 (Millipore) following the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunoprecipitation of m6A-modified transcripts was carried out with Magna MeRIP™ m6A Kit (Merck-Millipore, 17-10499) following the manual ...
-
bioRxiv - Microbiology 2022Quote: ... Chitinase activity of cell free supernatants was measured using a commercially available fluorometric chitinase assay kit (Sigma-Aldrich) following the protocol ...
-
bioRxiv - Genetics 2022Quote: The amplification of the whole mtDNA was performed with the Expand™ Long Range dNTPack kit (Sigma Aldrich) according to Fendt et al ...
-
bioRxiv - Immunology 2022Quote: ... The reaction was revealed with 3,3′-diaminobenzidine Substrate Kit for Peroxidase and fast blue substrate (both Sigma-Aldrich, St ...
-
bioRxiv - Molecular Biology 2022Quote: Cell growth was monitored by cell counting and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay using MTT cell growth assay kit (#CT02, Millipore). FL or ΔN-Drosha cells (1×105 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lactate and pyruvate were measured in the protein-depleted flow-through using assay kits (MAK064-1KT, Sigma-Aldrich) and (ab65342 ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant and standards containing bovine serum albumin (BSA) were analyzed using a BCA protein assay kit (Sigma).
-
bioRxiv - Bioengineering 2022Quote: ... we cultured T-SLICE in the presence of 100 μM of the EF5 Hypoxia Detection Kit (Sigma-Aldrich). Cell culture media was supplemented with 100 μM EF5 incorporated into the media for 6 ...
-
bioRxiv - Bioengineering 2022Quote: Measurements of L- and D-lactic acid were using standard D- and L-lactate assay kits (Sigma-Aldrich) according to manufacturer’s instruction after optimization (Supplementary Fig ...
-
bioRxiv - Developmental Biology 2022Quote: ... The ChIP assay was performed according to the manufacturer’s instructions (EZ-Magna ChIPTM A/G kit, EMD Millipore). In brief ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA was extracted using Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, United States) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: DNA (0.5-1µg) was bisulfite treated using the two-step protocol of the Imprint DNA Modification Kit (Sigma). converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN) ...
-
bioRxiv - Genomics 2022Quote: ... Single nuclei from fetal brain were isolated using Pure Prep Nuclei Isolation kit (Sigma, St. Louis, MO, USA) as per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Full length CDS of DvCHR was labelled with the DIG RNA Labeling Kit (Sigma-Aldrich, St. Louis, USA). The probe was hybridized to the membrane at 50 °C overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from freshly ground tissue using the Spectrum™ Plant Total RNA Kit (Sigma Aldrich). RNA samples were used to generate sequence libraries using a library prep kit from New England Biolabs (NEB #E7530) ...
-
bioRxiv - Microbiology 2022Quote: Serum cytokines were determined using a custom premixed Milliplex Map porcine cytokine/chemokine magnetic beads kit (Millipore, USA) for 13 cytokines i.e ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2018a). An Ellman assay (Ellman et al. 1961) was performed using an Acetylcholinesterase activity assay kit (Sigma-Aldrich). Absorbance was read at 412 nm every minute for 10 minutes using a VersaMax (Molecular Devices ...