Labshake search
Citations for Millipore Sigma :
4751 - 4800 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... They were then given access to bottles with water containing 3% sucrose (Sigma-Aldrich #16104) or pure water ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Standard samples of 3-oxo-C12-HSL and C4-HSL were purchased from Sigma-Aldrich. The cell-free reaction samples were preprocessed using HPLC (Supplementary Methods) ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were harvested by trypsinisation in 3 ml 0.25% trypsin-EDTA solution (Sigma-Aldrich, T3924), which was then inhibited by adding 4 ml of ice-cold KHM buffer (110 mM KOAc ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 12.5 µl of 3 mM 4- methylumbelliferyl N-acetyl-β-D-glucosaminide (Sigma-Aldrich) followed by incubation for 30 min at 37°C ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... brain slices were blocked in a solution containing 3 % donkey serum (DS) (D9663, Sigma-Aldrich) and 0.3 % Triton X-100 (T ...
-
bioRxiv - Neuroscience 2021Quote: DIV 3 hippocampal neurons were treated with 1μM of (+)-MK-801 hydrogen maleate (Sigma, M107) for 30 min at 37ºC to reduce spontaneous rod formation ...
-
bioRxiv - Neuroscience 2021Quote: DIV 3 hippocampal neurons were treated with 1μM of (+)-MK-801 hydrogen maleate (Sigma, M107) for 30 min at 37ºC to reduce spontaneous rod formation ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then washed with PBS and incubated with blocking buffer containing 3% BSA (Sigma) at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Microbiology 2020Quote: ... Endogenous peroxidase activity was inhibited using 3% H2O2 in molecular-grade methanol (Sigma-Aldrich, Germany). Slides were washed with phosphate buffered saline (PBS ...
-
bioRxiv - Immunology 2021Quote: ... or 400µg NP-PCC (4-hydroxy-3-nitrophenylacetyl (Biosearch) conjugated to pigeon cytochrome C (Sigma)) mixed with adjuvant based on Monophosphoryl Lipid A ...
-
bioRxiv - Microbiology 2020Quote: ... mouse splenocytes were plated at 3 × 105 / well into 96-well filtration plates (Millipore, USA) pre-coated with capture antibodies and stimulated with 5 µg / well purified JEV or ZIKV particles for 60 h at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... The DRG cells were then passed over a 3% bovine serum albumin (BSA) (Sigma-Aldrich) gradient and resuspended in Neurobasal-A medium (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... The plates were developed with commercially available 3-Amino-9-ethylcarbazole (AEC) substrate (Sigma-Aldrich). The observed spots were counted using an ELISPOT plate reader by ZellNet and the final data was reported as spot forming cells (SFC ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3 days and expanded prior to seeding into triple flasks (Nunc® Sigma-aldrich). Expression was induced with 1 μg mL-1 doxycyclin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated for 20 min in blocking buffer: PBS 3% BSA (Sigma, A4503), incubated for 1 h with H3PS10 antibody (1/1000) ...
-
bioRxiv - Cell Biology 2021Quote: ... They were then washed three times in PBS before blocking in 3% BSA (A8806; Sigma) in PBS for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... Amicon® Ultra-15 Centrifugal Filter Units (3 kDa MWCO) were purchased from Millipore Sigma. Atsttrin was supplied by Synermore Biologics Co. ...
-
bioRxiv - Neuroscience 2021Quote: ... Germany) was treated with hexam-ethyldisilazane (HMDS) (CAS number: 999-97-3, Sigma-Aldrich, Germany) and dehydrated at 125°C to enhance adhesion to its surface ...
-
bioRxiv - Microbiology 2021Quote: ... Calu-3 stocks were additionally cleared using a 0.45 μM low protein binding filter (Millipore) to remove mucus debris produced by these cells and the medium was exchanged three times for Opti-MEM I (1X ...
-
bioRxiv - Neuroscience 2020Quote: ... Mice in the MOD groupreceived bilateral infusions of STZ (Sigma-Aldrich, s0130; 3 mg/kg) dissolved in 0.9% sterile saline into the hippocampus on both coordinates with a constant rate (500 nL/min ...
-
bioRxiv - Cell Biology 2020Quote: ... enteroid monolayers were maintained in OBM supplemented with 3 μM CHIR-99021 (Sigma Aldrich #SML1046), 50 ng/mL murine EGF (Invitrogen #PMG8043) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Measurements were recorded in the presence of 2.5 mM ADP (state 3 respiration, Sigma, A2754) and the absence of ADP (state 2 respiration ...
-
bioRxiv - Cancer Biology 2022Quote: ... The nitrocellulose membrane was blocked with 3% (w/v) non-fat milk (#70166; Sigma-Aldrich), 0.1% Tween-20 in TBS ...
-
bioRxiv - Physiology 2022Quote: ... five male or female flies (3 - 4 d old) were extracted with hexane (Sigma Aldrich) spiked with 10 μg/ mL of hexacosane (Sigma Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... cells were resuspended in a 1x Sybr® green (Sigma-Aldrich CAS: 163795-75-3), at RT for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and covered with a 25-mm glass (Fisher) coverslip pretreated with 3-aminopropyltrimethoxysilane (Sigma-Aldrich) and glutaraldehyde (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... and 3) M9+0.05% Ty+0.009 g/mL MBC+ 0.69 mM cholesterol (Sigma, cat. #C8667). Cultures were grown at 37° C with shaking and OD600 was monitored for each strain using a plate reader (BioTek) ...
-
bioRxiv - Microbiology 2023Quote: ... the virus inoculum was removed and phenol-red free DMEM supplemented with .3% BSA (Sigma), 100U/ml pen/strep (Life Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... 3 more washes were performed and the samples were developed with PNPP (Sigma, N-9389) in PBS for 15 minutes and the results were read with a spectrometer plate reader at 405nm.
-
bioRxiv - Microbiology 2023Quote: ... Larvae were anesthetized in E3 water (E3) + 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate, Sigma) prior to all experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were washed by PBS and blocked in 3% bovine serum albumin (BSA, Sigma–Aldrich) for 30 min at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the supernatant was transferred to Amicon® Ultra-0.5 3 kDa filter columns (Merck Millipore) and centrifuged at 14,000 × rpm for 1 hour ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.5) and incubated with 3 mg of Biotin HRV-3C protease (Sigma, cat# 95056) to remove the GST-tag ...
-
bioRxiv - Neuroscience 2023Quote: ... 3′-diaminobenzidine (DAB; Cat#DS905, Sigma-Aldrich; 50 mg/100 ml in 0.1 M TB) in 40 μg/ml ammonium chloride (NH4Cl ...
-
bioRxiv - Pathology 2023Quote: ... Measurements were recorded in the presence of 2.5 mM ADP (state 3 respiration, Sigma, A2754) and the absence of ADP (state 2 respiration ...
-
bioRxiv - Neuroscience 2023Quote: ... The 3 µm slides were rinsed with TBS containing 0.025% Triton X-100 (Sigma–Aldrich) twice for 5 min and they were then were blocked in 1% bovine serum albumin (BSA ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then added to 3 mL of HIS Select Nickel affinity gel (Sigma) equilibrated in wash buffer (10 mM NaPO4 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells (0.8-3 × 104 cells) were seeded on poly-L-lysine (0.01%, Sigma-Aldrich, #P8920) and fibronectin (10 μg/mL ...
-
bioRxiv - Genetics 2023Quote: ... Thermofisher) in the presence of 3% BSA and 3x Proteinase/Phosphatase Inhibitors cocktail (Sigma-Aldrich). After overnight incubation samples were additionally incubated with Pierce™ Streptavidin Plus UltraLink™ Resin (Thermofisher ...
-
bioRxiv - Biochemistry 2023Quote: ... 2.5 mM DTT) using Amicon Ultra-15 Centrifugal Filters (Millipore #UFC900324, 3 kDa cut-off).
-
bioRxiv - Evolutionary Biology 2023Quote: ... they were anesthetized using 30 mg/L MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich). The skin tissue was taken from the right side near the back of each individual in approximately 0.8 × 1.0 cm under sterile conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were fixed with 3% PFA (paraformaldehyde, cat#158127, Merck Millipore, Burlington, MA, USA) for 10 min and subjected to immunofluorescence ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then added to 3 mL of HIS Select Nickel affinity gel (Sigma) equilibrated in wash buffer (10 mM HEPES ...
-
bioRxiv - Cancer Biology 2023Quote: ... Excess DBCO reagent was removed using Amicon Ultra Centrifugal Columns with 3 kDa cutoff (Millipore). A volume of 30 μL of resulting solution was run on an SDS-PAGE gel and imaged using the ChemiDoc MP System (BioRad) ...
-
bioRxiv - Neuroscience 2023Quote: ... dTg fish that underwent Experiment 3 were treated at day five with 1mM BrdU (Sigma) diluted in water with 0.33% DMSO for 4 h ...
-
bioRxiv - Microbiology 2023Quote: ... the virus inoculum was removed and phenol-red free MEM supplemented with 3% BSA (Sigma), 100U/mL of penicillin and 100ug/mL of streptomycin mixture (Life Technologies) ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Molecular Biology 2023Quote: ... non-toxic dose of LPS (3 ng/mL; from E. coli O128:B12, Sigma-Aldrich) was added and incubations continued for 23 hours ...