Labshake search
Citations for Millipore Sigma :
3951 - 4000 of 10000+ citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Embryos were dechorionated with pronase and subsequently raised in E3 supplemented with 45 µg/mL 1-phenyl 2-thiourea (PTU, Sigma-Aldrich) from one day post fertilization ...
-
bioRxiv - Molecular Biology 2024Quote: ... The stained cells were mounted on a coverslip with a mounting medium containing 1 µg/mL 4ʹ,6-diamidino-2-phenylindole (DAPI) dilactate (Sigma, D9564) and 100 µg/mL p-phenylenediamine (PPD ...
-
bioRxiv - Neuroscience 2024Quote: ... Animals were grown in E2 medium (Westerfield, 2000) with the addition of 200 μM 1-phenyl-2-thiourea (PTU, Sigma, P7629) from 1 day post fertilisation (dpf ...
-
bioRxiv - Neuroscience 2024Quote: ... third-instar larvae were dissected in ice-cold larval Ringer’s solution with a 1:100 dilution of phosphatase inhibitor cocktail 2 (Sigma-Aldrich, P5726). Tissues were fixed in 4% paraformaldehyde with 1:100 phosphatase inhibitor cocktail 2 in PBS for 60 minutes at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were transferred to BABB solution (1:2 ratio of benzyl alcohol, Sigma-Aldrich, 305197; and benzyl benzoate, Sigma-Aldrich, B6630) for three hours ...
-
bioRxiv - Neuroscience 2024Quote: ... in saline solution 2 ml of Evans blue albumin (EBA, 5% bovine albumin labelled with 1% Evans blue; molecular weight: 68 kDa, Sigma Chemicals) for 1 h.[2] Finally ...
-
bioRxiv - Bioengineering 2024Quote: ... Trans-2-[3-(4-tert-Butylphenyl)-2-methyl-2- propenylidene]malononitrile (DCTB) (100 mg mL-1 in ACN) was used as the matrix without further purification (Sigma-Aldrich). NaTFA salt was used as the ionization agent (1 mg mL-1 in MeOH) ...
-
bioRxiv - Microbiology 2024Quote: ... These cell lines were generated by the transduction with lentiviruses expressing the 2 subunits of a PARP-1-specific zinc-finger nuclease (Sigma, CKOZFN1116). Transduced cells were subjected to single cell-cloning ...
-
bioRxiv - Immunology 2024Quote: ... the samples were dehydrated with increasing methanol series and subsequently optically cleared in glass-bottom microwell dishes first with 50 % benzyl alcohol (Honeywell) 1:2 benzyl benzoate (BABB; Sigma–Aldrich) in methanol and then with 100 % BABB ...
-
bioRxiv - Pathology 2024Quote: ... rinsed quickly in 1 change of acetic acid solution prior to mounting in 95% alcohol with 2 changes in Histoclear solution (Sigma-Aldrich) followed by mounting in synthetic resin ...
-
bioRxiv - Neuroscience 2024Quote: Sections were blocked using 10% donkey serum in 0.1% Triton X 100 in PBS and then stained with primary antibodies (Oxytocin Polyclonal Antibody, Invitrogen, Rabbit Polyclonal, Cat #PA5-26701, 1:1000 and Anti-Neurophysin 2/NP-AVP Antibody, clone PS 41, Millipore Sigma, Mouse Monoclonal ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mL of blocking buffer was prepared per 2 x 108 cells by adding 1 g of biotin-free BSA (Sigma Aldrich) and 200 mL of 0.5 M pH 8.0 EDTA into DPBS (GIBCO) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: The 5-HT2C antagonist 6-Chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxamide dihydrochloride (SB242084; Sigma Aldrich) at a dose of 1.0 mg/kg.
-
bioRxiv - Biochemistry 2024Quote: ... the two purified proteins in crystallization buffer were mixed in a 1:1.2 ratio with 2 mM AMPCPP (Millipore Sigma, M6517), incubated on ice for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... livers were washed 3 times with PBS and incubated 1 hour at room temperature with blocking solution (PBS containing 2 % BSA, Sigma Aldrich) followed by incubation at 4 °C overnight with primary antibody staining (blocking solution containing 1:100 primary antibody) ...
-
bioRxiv - Bioengineering 2024Quote: ... hiPSC-L1- mCherry cells were seeded at a density of 15,000 cells per cm² on Matrigel-coated 6-well plates in Essential 6 medium supplemented with 1% penicillin-streptomycin and containing 2 μM ROCK inhibitor (Thiazovivin, Millipore Sigma). After 24 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were treated with nocodazole (0.5 μg ml-1) and BrdU (100 μM) with or without aphidicolin (2 μM; EMD Millipore Corp). Cells were collected 36 h post-irradiation ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell pellets were resuspended in 80 ml of lysis buffer (50 mM HEPES-NaOH pH 6.8, 1 mM DTT, 2 mM EDTA, protease inhibitor cocktail (Sigma-Aldrich, P8340) diluted 1:800 ...
-
bioRxiv - Bioengineering 2024Quote: ... The stromal cells were pelleted down by centrifugation and put back in complete low glucose DMEM with 1X antibiotic and amphotericin supplemented with 2 mM L-glutamine and 1 ng/mL basic fibroblast growth factor (bFGF) (Sigma, USA). Lastly ...
-
bioRxiv - Cell Biology 2024Quote: ... Human EndoC-βH3 cells (Human Cell Design) were cultured on 2 µg/mL fibronectin and 1% extracellular matrix (E1270, Sigma-Aldrich) coated plates in Advance DMEM/F-12 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Heat-induced antigen retrieval was performed in a hot water bath in pH 9 Tris/EDTA buffer or pH 6 citrate buffer and stained with primary antibodies anti-beta-2-microglobulin antibody (1:1000, HPA006361 Sigma-Aldrich), anti-beta-2-microglobulin antibody (1:100 ...
-
bioRxiv - Cell Biology 2024Quote: ... was transferred into a new microcentrifuge tube containing 40 ± 2 mg of a mixture (7:1) of anhydrous sodium sulfate (Sigma-Aldrich) and primary secondary amine (PSA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µl of 1x Lysis Buffer were added (20 mM Tris-HCl pH8, 150 mM NaCl, 2 mM EDTA, 1x Protease Inhibitor Roche, #04693116001, 1% NP40 Sigma, #I8896), the embryos were smashed by pipetting up and down several times and the samples were centrifuged at 4 °C at maximum speed for 15 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... a single dose of 1 mg of 4-hydroxytamoxifen (4-OHT, H7904, Sigma, ≥98% Z (trans) isomer ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl of 0.5 nmol α-Cyano-4-hydroxycinnamic acid (4-CIN, Sigma Aldrich, Cat #: C2020) dissolved in ACSF containing DMSO (Wang ...
-
bioRxiv - Physiology 2022Quote: ... 2-bromopalmitate (2-BP) was delivered with fatty acid-free bovine serum albumin (Sigma-Aldrich, A6003) at a stock concentration 1 mM albumin with 5 mM 2-BP ...
-
bioRxiv - Biochemistry 2020Quote: ... 2-acetazolamide and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Millipore-Sigma ...
-
bioRxiv - Immunology 2021Quote: ... Materials for interference testing included 2-phenoxyethanol (2-PE) (77699-250ML, Sigma-Aldrich, St Louis, MO), sodium citrate tribasic dihydroxide (C8532-100G ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 pmol (2 µL of stock) of the non-labelled AQUA® peptide HLEAAKGYSFTTTAEKAAELHK (Sigma-Aldrich) containing the quantification tag sequence GYSFTTTAEK was added to enable quantification of SIL-protein stock concentrations using MS analysis based on the ratio of heavy-to-light GYSFTTTAEK signals (see below) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bacterial Glycerol Stock Sequence (same as Construct 2) 2# CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG) constructs were purchased from Sigma Aldrich. The plasmids were packaged into Lentiviral particles using the 2rd generation packaging plasmid (Addgene) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected approximately 2 μL of DNA (2 μg/μL) mixed with 0.1% Fast Green (Sigma) in PBS into a lateral ventricle of the embryonic brain with a pulled glass micropipette ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein sample (400 μg) was reduced by adding 2 μl of Tris(2-carboxyethyl)phosphine (Sigma) and incubating samples at 60 °C for 1 h ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was applied on an already equilibrated 2-(2-pyridyl)ethyl columns (Sigma 54127-U) with 1 ml of 50% MeOH with 2% acetic acid ...
-
bioRxiv - Plant Biology 2023Quote: ... 2% ß-mercaptoethanol and 2 tablets/10ml of complete EDTA free protease inhibitor (Sigma Aldrich, USA), 100μM E-64 cysteine protease inhibitor (Bera et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 2-hydroxyibuprofen (2-OH-IBU) and carboxyibuprofen (CBX-IBU) were obtained from Sigma-Aldrich (Steinheim, Germany). All chemicals and solvents used were of the highest purity available.
-
bioRxiv - Neuroscience 2022Quote: ... The retinas were dissected and embedded in 2% low melting agar (2-hydroxymethyl agarose, Sigma Aldrich), mounted on a vibratome (DSK Microslicer ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were incubated for 2 hours at room temperature with 2% normal donkey serum (Sigma, G6767) in PBS overnight at 4 °C with c-Fos primary antibodies (226003 ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were deeply anesthetized with avertin (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) and transcardially perfused with PBS followed by 4% paraformaldehyde in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were deeply anesthetized with avertin (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) and transcardially perfused with PBS followed by 4% paraformaldehyde in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3-(4,5-dimethylthiazolyl-2-yl)-2–5 diphenyl tetrazolium bromide (MTT, Sigma, St. Louis, Missouri, USA) was introduced ...
-
bioRxiv - Immunology 2024Quote: ... and 2 μg/ml of L-tosylamido-2-phenyl ethyl chloromethyl ketone (TPCK) (Sigma-Aldrich, MO). The virus containing supernatant was harvested after 72 hours and the viral titer was determined by standard plaque assay ...
-
bioRxiv - Neuroscience 2024Quote: Under Avertin anesthesia (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) male A2A-Cre and D1-Cre mice (≥ 8 weeks old) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were then diluted 1 in 4 with PBS then pelleted and re-suspended in 1 ml of PBS containing 1 % BSA (Sigma-Aldrich, #A2058). Cells were again pelleted ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were blocked with goat serum diluted 1:200 in PBS for one hour followed by an overnight incubation at 4°C with the primary antibody (HIF-1α, 1:200, described in32; BACH-1, 1:200, Sigma Aldrich HPA034949) Next ...
-
bioRxiv - Molecular Biology 2021Quote: ... were blocked for 1 hr at 4°C in Buffer BC150 containing 1% fish skin gelatine (Sigma) and 0.2 mg/ml BSA (New England Biolabs) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... at a dose of 1 ml/kg (diluted 1:4 in corn oil, both from Sigma-Aldrich). In parallel control animals received the corresponding vehicle injections ...
-
bioRxiv - Physiology 2023Quote: ... and mixed with 1 M HEPES solution in a 1:4 ratio (Sigma-Aldrich, St. Louis, MO) to cell culture ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated overnight at 4° C (MAP2 1:1000 Invitrogen #MA5-12826, GABA 1:1000 Sigma Aldrich #A2052). Cultures were washed 2X with D-PBS and blocking performed using 5% donkey serum for 10 min ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2 mmol/L MgSO4 (Millipore Sigma), 0.1 mmol/L CaCl2 (Millipore Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mM glutamine (G8540, Sigma-Aldrich), 100 units/ml penicillin G (P3032 ...