Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 5-Iodo-2-deoxyuridine (IdU; Sigma, 100uM) and puromycin (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... alpha-tubulin (B-5-1-2, Sigma), tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Dimethyl 2-oxoglutarate (5 mM; Sigma, 349631), and 3-Mercaptopicolinic Acid (5 mM ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 5% 2-mercaptoethanol (Sigma-Aldrich) for western blot.
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... containing 5% 2-Mercaptoethanol (Millipore Sigma; M3148) and boil the samples at 95°C for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5-Fluoro-2’-desoxyuridine (Sigma # F0503), was added to a final concentration of 3 µM on the third day and the medium was exchanged three times per week.
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with 5% 2-betamercaptaethanol (M3148, Sigma) was added to each sample ...
-
bioRxiv - Developmental Biology 2024Quote: For BrdU (5-Bromo-2’-deoxyuridine, Sigma) labeling ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% 2-mercaptoethanol (Sigma-Aldrich) for western blotting.
-
bioRxiv - Immunology 2023Quote: 5-bromo-2’-deoxyuridine (BrdU; Sigma-Aldrich) was diluted to 5mg/ml in sterile PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-Iodo-2’deoxyuridine (IdU-Sigma-Aldrich) was used for 20 hours at 100μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-Chloro-2’-deoxyuridine (CldU) (Sigma; #C6891). LP and SP (Bachem ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-Iodo-2’-deoxyuridine (IdU) (Sigma; #I7125), 5-Chloro-2’-deoxyuridine (CldU ...
-
bioRxiv - Microbiology 2023Quote: ... with 5% 2-Mercaptoethanol (Sigma-Aldrich, M3148) and denatured at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-aza-2’-deoxycytidine (DAC, Sigma A3656) was dissolved in DMSO:PBS at a ratio of 1:150 and stored at −80°C ...
-
bioRxiv - Cell Biology 2023Quote: – 5-ethylene-2′-deoxyuridine (EdU) (Sigma-Aldrich) was dissolved in sterile DMSO at 125 mM and stored at –20°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 5% 2-Mercaptoethanol (Sigma-Aldrich, M6250) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-5 (100081) was purchased from Sigma.
-
bioRxiv - Neuroscience 2024Quote: ... 5-bromo-2’-deoxyuridine (BrdU; Sigma-Aldrich) was intraperitoneally injected into the mice for the last 5 days of ZSS treatment ...
-
bioRxiv - Neuroscience 2024Quote: ... 5-bromo-2′-deoxyuridine (BrdU, Sigma□Aldrich) was injected intraperitoneally at 50 mg/kg into sedentary mice ...
-
bioRxiv - Neuroscience 2024Quote: ... 5-bromo-2-deoxyuridine (BrdU, Sigma Aldrich). We administered intraperitoneally a single injection of a 10 μL of a 50 mg/ml BrdU solution in PBS immediately after the bulbar lesion ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-Amino 5-nitrothiazole was from Sigma, and the remaining compounds (4-Aminobenzanilide ...
-
bioRxiv - Neuroscience 2020Quote: ... N-methyl-DL-aspartic acid (NMA) and 5-hydroxytryptamine creatinine sulfate (5-HT) were obtained from Sigma-Aldrich. Other drugs ...
-
bioRxiv - Cell Biology 2024Quote: ... auxin (3-indoleacetic acid, Sigma 13750, 2 M stock in DMSO) was added to one subculture for a final concentration of 2 mM ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Cancer Biology 2022Quote: ... then treated with 1 uM of 5-Aza-2-deoxycytidine (5 –Aza, SIGMA, A3656) or PBS for 4 days ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Complementary guide oligonucleotides (forward: 5’-CACCGCAGGATTGAAGACCTTAACA-3’; reverse: 5’-AAACTGTTAAGCTCTTCAATCCTGC-3’) were custom synthesized separately by Sigma-Aldrich (St. Louis, MO, USA), annealed ...
-
bioRxiv - Biophysics 2021Quote: ... The primers used for the same were a) A350P forward 5’-gctgcatccggccgcatctcggc-3’ and b) A350P reverse 5’-gccgagatgcggccaaggatgcagc-3’ (Sigma Aldrich, India). Full length A350P was thereafter cloned into an empty pEGFP (Clontech ...
-
bioRxiv - Developmental Biology 2024Quote: The SHMT2 gene was cloned from cDNA of HeLa cells using primers 5’-GCCCATATGGCCATTCGGGCTCAGCAC-3’ (forward) and 5’-GCCCTCGAGATGCTCATCAAAACCAGGCA-3’ (reverse) and subcloned into the pET41a vector (Novagen, WI, USA) at restriction enzyme sites of NdeI and XhoI ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were washed 2-3 times with warmed PBS followed by 50 μM 5-chloro-2’-deoxyuridine (CldU, Sigma #C6891) for 20 minutes or 50 μM CldU with 4mM hydroxyurea (HU ...
-
bioRxiv - Immunology 2023Quote: ... and 2 x 10-5 M 2-mercaptoethanol (Sigma-Aldrich) and used directly in functional experiments.
-
bioRxiv - Cancer Biology 2021Quote: HDMB03 cells (3×105 in 6-well plates) were treated with global de-methylating agent 5-AzaC (5 μM) (5-Aza-2-deoxycytidine; Sigma). Following 96 hours of incubation ...
-
bioRxiv - Neuroscience 2022Quote: ... the cells were treated with 1 x 10-5 M 5-fluoro-2-deoxy-uridine and with 1 x 10-5 M uridine (Sigma) for 3 days ...
-
bioRxiv - Bioengineering 2020Quote: ... were added to 1 mL of a 0.1M solution of 5-norbornene-2-carboxylic acid in 0.1M phosphate buffer (pH 6.0) (all reagents purchased from Sigma-Aldrich). The solution was allowed to react at room temperature with intermittent vortexing ...
-
bioRxiv - Cell Biology 2020Quote: ... the hSCOs were either cultured in DM containing AEDs (valproic acid, 0.5 or 1 or 2 mM, Sigma, P4543; carbamazepine, 5 or 50 or 100 μM, Sigma, C4024 ...
-
bioRxiv - Neuroscience 2022Quote: ... and NMDA receptor mediated PSCs were blocked with DL-2-amino-5-phosphonopentanoic acid (D-AP5; 50 μM; Sigma). The AMPA-R PSC frequency and amplitude was determined from a 1 min interval after the recording had stabilized (~10 min after wash-in of picrotoxin/D-AP5) ...
-
bioRxiv - Bioengineering 2023Quote: ... Di-tert-butyl decarbonate (BoC2O) and 5-norbornene-2-carboxylic acid were purchased from Sigma Aldrich (St. Louis, MO). Irgacure 2959 was purchased from Advanced Biomatrix (Carlsbad ...
-
bioRxiv - Cell Biology 2024Quote: ... consisting of 1% FBS and gluMax along with 5 μM CHIR99021 and 2 μM retinoic acid (R2625, Sigma-Aldrich) for 72 hrs ...
-
bioRxiv - Neuroscience 2024Quote: ... and then in 0.175 M sodium acetate (14.36 mg/ml in ddH2O, pH 6.8, adjusted with glacial acetic acid, 2 × 5 min; Cat# S8750, Sigma-Aldrich). Sections were reacted in 0.5 mg/ml 3 ...
-
bioRxiv - Pathology 2022Quote: ... Day 7 differentiated WT and ABHD4 KO 3T3-L1 adipocytes were labeled with 0.5 μCi [14C]-acetic acid or 5 μCi [3H]-oleic acid plus 0.04 mM oleic acid (Sigma-Aldrich) conjugated with 0.01 mM fatty acid free-bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μM carbonyl cyanide 3-chlorophenylhydrazone (Sigma Cat # C2759) and 5 μM valinomycin (Sigma Cat # V0627) ...
-
bioRxiv - Genomics 2021Quote: ... a 3-day puromycin (5 μg/mL, Sigma, P8833) selection was performed 48 hours after the spin-inoculation ...
-
bioRxiv - Biophysics 2020Quote: ... mglBΔCT-R (5’-CGTAAAGCTTTTACACCAGGCTCTCGAAGATCTTCGTGAGCTC-3’ synthesized by Sigma-Aldrich, India ...
-
bioRxiv - Neuroscience 2021Quote: ... or non-targeting siLUC (5’-UAAGGCUAUGAAGAGAUAC-3’, Sigma-Aldrich) were mixed with 54 μl of RNAiMAX (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... moxidectin (3 nM) (Millipore Sigma, Catalog # 113507-06-5), ricobendazole (25 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the siRNA duplex 5′-UUCUCCGAACGUGUCACGUdTdT-3′ (Sigma). The cells were further processed according to the experimental design and depletion was assessed by immunofluorescence ...