Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (Sigma) was used at a final concentration of 1mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate; Sigma).
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Systems Biology 2020Quote: BALB/cJ mice were subjected to cutaneous Oxazolone (Oxa) challenge by applying 5% 4-Ethoxymethylene-2-phenyl-2-oxazolin-5-one (Sigma-Aldrich) in acetone and olive oil topical to the skin as described [74] ...
-
bioRxiv - Immunology 2022Quote: Mice were sensitized on the shaved back-skin for two consecutive days with 50 μl of 5% Oxa (4-Ethoxymethylen-2-phenyl-2-oxazolin-5-on, Sigma-Aldrich) diluted in methanol and acetone (1:1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein extracts were reduced with 5 mM 5-Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) (Sigma-Aldrich) for 2 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were treated with 5 μM FDU (5-fluoro-2’-deox-yuridine, Sigma-Aldrich, MO, USA) to further reduce the number of glial cells ...
-
bioRxiv - Cell Biology 2020Quote: ... dissolved in 5 ml 0.03 M aspartic acid (Sigma, 11189, pH 5.0)) for 120 mins at 50 °C ...
-
bioRxiv - Physiology 2021Quote: ... Drugs used were: kainic acid monohydrate (Sigma-Aldrich, Cat # K0250. 5 μM); phrixotoxin-3 (PTx3 ...
-
bioRxiv - Biochemistry 2020Quote: ... Membrane strips were blocked with 5% fatty acid free BSA (Sigma Aldrich) and then incubated with anti-oligomer specific antibody (A11 ...
-
bioRxiv - Cancer Biology 2024Quote: Treatment with oleoyl-L-α-lysophosphatidic acid (LPA; 5 µM; Sigma, L7260) was carried out by addition to media of live cells for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then resuspended in 200ul of 5% metaphosphoric acid (Sigma-Aldrich) with 1mM EDTA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-Dihydroxybenzoic acid (DHBA, D110000, Sigma-Aldrich, USA; final concentration 80 µM) was dissolved in PBS as well ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with cold 95% methanol/5% glacial acetic acid (Sigma) and washed extensively with PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... which was coated with 5% Pluronic acid F-127 (Sigma-Aldrich P2443) and rinsed with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 µM 5-Methyltetrahydrofolic acid disodium salt (5ME-THF, #M0132, Sigma-Aldrich); 5 µM Hypoxanthine (#H9636 ...
-
bioRxiv - Microbiology 2024Quote: ... or 30 mM of neutralized 5-oxoproline (L-pyroglutamic acid, Sigma-Aldrich), as indicated ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5 μM PMA and 150 μM ascorbic acid (Sigma – A8960-5 g). Upon formation of neuroepithelial structures ...
-
bioRxiv - Cell Biology 2024Quote: ... at 5 μg/cm2 in 0.02 N acetic acid (100063, Sigma-Aldrich) for one hour at room temperature ...
-
bioRxiv - Plant Biology 2023Quote: ... tubes were filled and replenished with a solution of 1 x 10-5 M abscisic acid (2-cis,4-trans-Abscisic Acid, 98%; Sigma-Aldrich; St. Louis MO, USA; product 862169). For the FC experiment ...
-
bioRxiv - Bioengineering 2022Quote: ... slides were stained in Phosphomolybdic Acid / Phosphotungstic Acid mix (Sigma-Aldrich, product number HT15-3 and HT15-2) for 7 minutes and in Aniline Blue Solution (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... 3-mercaptobenzoic acid (3-MBA, Sigma-Aldrich)-capped gold nanoclusters (3-MBA-Au nanoclusters ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.1% w/v Ferrozine (Disodium-4-[3-pyridin-2-yl-6-(4-sulfonatophenyl)-1,2,4-triazin-5-yl]benzosulfonate (Sigma-Aldrich) in dd ...
-
bioRxiv - Physiology 2020Quote: The reduction of yellow tetrazolium salt 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, Germany) was used to measure cellular metabolic activity as a proxy for cell viability [19,22] ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM MgCl2 6 H2O and 5-Bromo-4-chloro-3-indolyl β-D-galactoside or X-gal (Sigma, B4252 ...
-
bioRxiv - Cancer Biology 2021Quote: ... migrating/invading/transmigrating cells were incubated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 5 mg/ml, 1/10 volume; Sigma-Aldrich) added to the culture medium at 37°C for 4h ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, San Louis, MI, USA) solution in PBS was added to the cells and incubated for an additional 4 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were incubated with 5 mg/mL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma Aldrich) in PBS for 15 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... migrating/invading cells were incubated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 5 mg/ml, 1/10 volume; Sigma-Aldrich) added to the culture medium at 37°C for 4h ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MI, USA) solution was added to the cells and incubated for an additional 4 h ...
-
bioRxiv - Cell Biology 2023Quote: The cell proliferation assay was determined by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay (Sigma). All cancer cell lines were seeded in 24-well plates (2×104 cells/well) ...
-
bioRxiv - Cell Biology 2024Quote: ... After blocking of endogenous peroxidases (3% H2O2) and unspecific antibody binding (2% BSA+5%serum) PLAC8 antibody (HPA040465, Sigma) or SARS-CoV-2 Spike Glycoprotein S1 antibody (GTX632604 ...
-
bioRxiv - Cancer Biology 2023Quote: Culture medium was replaced with 100 µL medium containing 5 mg/mL filtered 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (#M5655, Sigma-Aldrich) and incubated for 2 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 30 μL of MTT [(3- [4,5-dimethyl-2-thiazolyl] -2,5-diphenyl-2H-tetrazolium bromide; 5 mg/mL; (Sigma-Aldrich)] was added in each well and the plate incubated for 3 hours at 25°C ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MI, USA) solution was applied to the cells and incubated for an additional 4h ...
-
bioRxiv - Developmental Biology 2023Quote: ... Fixed embryos were washed 3 times (5 minutes each) in wash buffer DPBS Tween containing 2% BSA (Sigma, A3311), and permeabilised at room temperature for 20 minutes in permeabilisation buffer 0.5% Triton-X in DPBS ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... media was aspirated from cells and replaced with 5 mg/mL 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, #M5655, Sigma Aldrich) solution in base media ...
-
bioRxiv - Cancer Biology 2024Quote: ... the cells were washed and followed by 3-hour incubation with 0.5 mg/mL MTT (3-(4, 5-Dimethylthiazol-2-yl)-2,5 diphenyl tetrazolium bromide) (Sigma-Aldrich). Cell apoptosis was measured with Annexin V Apoptosis Detection Kit I (BD Pharmingen ...
-
bioRxiv - Immunology 2020Quote: ... and product intensity measured by Software ImageJ(83) and normalized to ACTIN amplicon products (5’-GACGACATGGAGAAAATCTG-3’ and 5’-ATGATCTGGGTCATCTTCTC-3’, Sigma-Aldrich, St. Louis, Missouri, USA).
-
bioRxiv - Bioengineering 2020Quote: ... gels were fabricated with a final concentration of 1×105 AFC/mL (P3-5) and incubated in EGM-2 +/- 1 mg/mL of the plasmin inhibitor 6-aminocaproic acid (Sigma, A2504) at 37°C and 5% CO2 ...
-
bioRxiv - Genomics 2021Quote: ... after which it was quenched with 5 mM of ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA, Sigma, E3889). The quenched reaction was subsequently centrifuged for 5 minutes at 300 rcf and the supernatant was carefully discarded ...
-
bioRxiv - Microbiology 2023Quote: ... Washed beads were adjusted to pH 7.5 with 200 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) and bound proteins were reduced using 5 mM dithiothreitol (Sigma-Aldrich) at 37°C for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... The pelleted PRP was resuspended in PBS containing prostaglandin E1 (2 μM, Absin) and ethylene diamine tetra acetic acid (EDTA) (5 mM, Sigma-Aldrich) to prevent platelet activation ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5 µM (NMDA receptor antagonist that preferentially binds to GluN2C/GluN2D (40)) or DL-2-Amino-5-phosphonovaleric acid (APV, Sigma, A5282) 100 µM (broad spectrum NMDA receptor blocker).