Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Biochemistry 2024Quote: The DNA used in the crystallization of the NtcA-2OG-DNA complex was prepared by 10-min heating at 65°C of an equimolar mixture of the synthetic oligodesoxyribonucleotides 5’-AGCTGATACATAAAAAT-3’ and 5’-CATTTTTATGTATC-3’ (from Sigma) in 5 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Microbiology 2021Quote: ... were plated on synthetic complete (SC) plates containing 1□mg/ml 5-FOA (5-fluorotic acid; Sigma) and on non-selective SC plates/ ...
-
bioRxiv - Molecular Biology 2023Quote: ... The compounds 5-aza-dC (5-Aza-2’-deoxycytidine, A3656, Sigma, Shanghai, China) and RG108 (N-phthalyl-L-tryptophan ...
-
bioRxiv - Neuroscience 2020Quote: ... (+)-Bicuculline (No. 14340) and DL-2-amino-5-phosphonopentanoinc acid (APV; No. A5282) were obtained from Sigma-Aldrich; 6,7-dinitroquinoxaline-2,3(1H,4H)-dione disodium salt (DNQX ...
-
bioRxiv - Neuroscience 2023Quote: ... Stock solutions of the NMDA receptor antagonist DL-2-amino-5-phosphonovaleric acid (DL-APV; #5282; Millipore Sigma), GABAA receptor antagonist bicuculline methiodide (#14343 ...
-
bioRxiv - Cell Biology 2021Quote: ... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... followed by five minutes in 2% peracetic acid (Supelco, Denmark: Cas number: 79-21-0) and a rinse in 5 mL sterile water (Sigma-Aldrich, Germany, Cas number: 7732-18-5) as per the protocol by Tegtmeier et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... Peptides were extracted with 5% formic acid (Sigma F0507-1L), then 5% formic acid with 75% ACN ...
-
bioRxiv - Biochemistry 2020Quote: ... and 5-aminolaevulinic acid (ALA) were all from Sigma-Aldrich, and their stocks were made fresh in water ...
-
bioRxiv - Neuroscience 2022Quote: ... decanoic acid (CID: 334-48-5; Millipore Sigma; Catalog #:21409), undecanoic acid (112-37-8 ...
-
bioRxiv - Genetics 2022Quote: ... 5’-dithiobis-nitrobenzoic acid (DTNB-Sigma Chemical Co., St Louis). The reaction mixture contained 100 mM Tris-HCl buffer (pH 7.8 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mM N-methyl-DL-aspartic acid (NMA, Sigma-Aldrich), 10 – 20 mM Serotonin (5-HT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were precipitated by adding 5-sulfosalicylic acid (Sigma-Aldrich) to a final concentration of 1% ...
-
bioRxiv - Neuroscience 2022Quote: (2R)-amino-5-phosphonovaleric acid (AP5) was obtained from Sigma/Research Biochemicals Inc ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mg/mL 7-aminocephalosporanic acid (7-ACA) (Sigma-Aldrich), 5 µg/mL clavulanic acid (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mg/mL 6-animopenicillanic acid (6-APA) (Sigma-Aldrich), 5 mg/mL 7-aminocephalosporanic acid (7-ACA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 g/L aminocaproic acid (Sigma, A2 504-256-100G), penicillin/streptomycin] ...
-
bioRxiv - Immunology 2024Quote: ... 350 µM 5-aminolevulinic acid (ALA, A7793-500MG, Sigma-Aldrich), 20 mg/mL hemoglobin (Hb ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Biophysics 2021Quote: ... was performed using a pre-annealed DNA-RNA template (DNA45: 5’-TTCTTT ATCTCTTATTTCCTTCTATTTTCCACGCGCCTTCTATTT-3’; RNA13: 5’-[6FAM]-GGCGCGUGGAAAA-3’, Sigma Aldrich). The reaction buffer comprised 25 mM HEPES pH 7.2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 53 from the RNAi Consortium (clones TRCN0000087290 and TRCN0000087292 with target sequence 5’-GCGGGAGTATAGTGAGTTTAA-3’ and 5’-CGGACAGTTTGGCACAATCAA-3’, respectively, distributed by Sigma-Aldrich, Merck ...
-
bioRxiv - Microbiology 2023Quote: ... The bacterial DNA was used to amplify the entire 16S region by PCR [5′-AGAGTTTGATCCTGGCTCAG-3′ (forward) and 5′-AAGGAGGTGATCCAGCCGCA-3′ (reverse)] using Expand High-Fidelity Polymerase (Sigma-Aldrich). The PCR products were purified using the QIAquick PCR Purification kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... HEK 293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) or ATF4-targeted shRNA (5’-GCCTAGGTCTCTTAGATGATT-3’) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Neuroscience 2020Quote: ... N-methyl-DL-aspartic acid (NMA) and 5-hydroxytryptamine creatinine sulfate (5-HT) were obtained from Sigma-Aldrich. Other drugs ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5-bromo-2-deoxyuridine (BrdU, Sigma) was added to the culture media at a final concentration of 10 μM for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... otherwise 2-5% DMSO (Sigma, Cat# D9170) were used instead ...
-
bioRxiv - Cancer Biology 2021Quote: BrdU (5-Bromo-2-deoxyuridine) (Millipore, 203806) was used to assess cell proliferation and the assay was performed in 96-well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-bromo-2’-deoxyuridine (BrdU) (Sigma, 10280879001) solution was peritoneally injected into live mouse at a concentration of 150mg/kg ...
-
bioRxiv - Biophysics 2022Quote: ... 2 or 5% (PEG-8000, Sigma Aldrich); iv ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-fluoro-2-deoxyuridine (Millipore cat. # 343333) was added at a concentration of 4 µM to prevent glial cell overgrowth ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µM 5-fluoro-2’-deoxyuridine (Sigma), penicillin ...